Description :
From Genome Similarity Track
Location :
Scaffold_1706:2337- 5116
Sequence
2779 bases(100 bases per row)
GCAAGACAAGTTTCAAGCAGACGACGAGGATGTGATTTCGCTGTCCTCGTCCGAGGGTCCGTTCTCTCTGACGATGCGCGGCAGAGACGGCTCAGAGTAT
CTCTACGAGTCGTCGCTGTCGTCGGAGCGGAGTCTTGAGGAAGACGTGGCGTCGCTGCCGTCCTCAGACTACTACACGTCCAAGAAGCCGAGCTGCTATG
CGAACGGCAAGCCTACGACTGCGAGTATTTACTCGGACGAGAGCGACGATGACCTGCGCGGCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCTGCACAAGCTGCCGGCGCGCATGCGCACGTCGAGCGGCCAGTCGAGCGGCGCGCCGTCGCAGGAGAACTACAACATCTGAGCCG
CCGGCAGAGAGCGCCATTATTGAGTGTCTTGCGCCGAAAGAAGGTGGGAGATACGATGGAGGCATATAGGGAGTCCTTGTGTCTGTGTTTTGCTGTAGTG
ATTTTTTTGTTTTTCACGGGGGAAGGTTGAAGTTTTGCTTTGGGAAATAGTTGGTATTACTTTTGTTTTTTTTTGTAGTTTTAAAGCGGAGTGTGGAGTA
AGGCGAGCTAATAAATAATAAGCGAGTTGGGATACAGAACGACTTGGTACGAAGCATGAACTTGTAGCGCGCATTTATATATTTGCGACCTATGCATCCC
CTGTGTGGCTCATGTGGTTAGACAATGGAATGCGCTTCTTAAATGCGCACGAAGCGTCGCGCTTTTGCTTGTGTACTGTATGCGAATTGCATGCACGTTA
GTAATAAGCAGCTTGCCACCAGCATCTTCCTTTCCGTGAAATAGCATCACAGCCATATCGCCTTCCAAGCGGCATGATTGCCTTTCATGCTGGGATCGGA
TAGTGTTCATTCGTAAAGTTGAGCGGACGGAGGCGTCCCCCACGGTCCACTATGGAGATTCGCGAGGGAGAGACGCCCAATTTTAATAGAGAAAAACGGT
TCAGTGGCGTCTCTGCCGTCGTAATCAATTTTTAGTTTCTGCCACTACGCTTGCTTTTTGCTTTTTATGGAACGTCATGTGGCAAAAATTACTTCTATTT
TTTTTTACATACACGGTGGGTTCGATTTTCTACTGGAGCGCAAAGGTCGATTTTATGCTTTTTACCGATCACATTTTGCGCGCGAATTACGGATGTAGGA
GAGCTAATCTGCTTGGAATTAGGATACCGCAGCTGGTAATTCGTAGGTATCCGCTTGTGTTGCGTTGCAACTGCAGTCTCTGCGATGGGTTACACACAGG
CAGGTGGTTGCGGTTGTTGTTGTTGAAGCAAGCCACCCCACCCCATGCGTGCGGTCGATCCCAACCTGTAGGCTACAGGGNNNNNNNNNNNNNNNNNNNN
NNATCGACCCGCACGCTATGGTACGGCGTAGCACAGCGTGCGTGTGTCGTCCTTTTGGCAAAGATGCGTGTACTGCAAAACCACGACGACACGCACGTCC
GTACAGTACTGAGTAGGCATGTAGGCAATCAGGCGGTGACGCGCCTCGGCGAGCCAGTAGATGACGTCGTCGTCATGACTGTGCAAATATGCAAGTGTGC
ATTCTTTCTGTGAATCCGCGGCGTTTTCGCATATCCAAATAGCTTTGTCACACCTCTGCGGAATATAAAATACGCATGCCGTTGTTTTCAGTACGAGTCA
AAGCGTTGTACCGTTCGTTTACTTTTGGCATGCTCCAGTTTACCGCACAAACCTGCTCTCTCACTTGCTGCATTGCGTACACATTCTTCGATGCTCTTTC
TGGTCGCTGCGAGCCAATCAGATGCGTCGGCAAGGGAATTGCAGCATATCCAACGTGCCGAGCAGACGCATCCGTTGCAGCCGCGTCAAGTGTCTGTTGC
AGGTCGGTCGGAGTGGCTTCAACTTGCGGACTCGACTAACTGACTGGTTGGCTCTATAGTGAGGGTCATGTGGACAATTCCGCCTCGGATGACGGCGAAG
AGACATGGAGAGTGGCAGATGTCCCACAGATACCCGTCAACAATATATTATATCCCACCCTATTCAACTCGGGTTTTTATAACCCATATCTTTTAGTAAC
CCACTGATCCTCTATTTCCATACATAAATTCAGTTTAATACAACCCACGGGTTGTTCTCTTGACCCGGTTTCTTTATTTTGTTTATTATTGTAATTTGCT
GAGCTTAACACAAAACCACCCCTACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATAGAAAAAGAAAAGCGCCCCAGAAA
CCAAGATCGCAAGATCGCAAGCCACATGCACCCCGTCTGCTCCACAATCCAACGACAACCATACGCGCCACTCTCCATTATATTTTGTCTAATATGCTGT
CCCCATACAAAAGCGCCACCCAACGCCGCCGNNNNNNNNNNTCCCCCTCCTCCTCCTTTCTTCTCCCTGCGTACATATCGGAAGGCGCTGGCGTAGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTTTCG
TACCCTCCAGGTAAGAAGCAACCAAATTCACACGCGTGAGTGCGCACCACCCATCCGTTTGTAGCTTTTGGCGATCTTTTTGGGTGTGACGGTTTTACAT
ACGAGTCTGACGGAAGATCGCTTAGCGCACGCACGGTGAAGCAAGTGAACCGCGCGCGCCTCTTGACAAACAATCCGCA