Description :
From Genome Similarity Track
Location :
Scaffold_67:233632- 238439
Sequence
4807 bases(100 bases per row)
TAACTTTGGGTTACATGACACACACGCTGTGATCAAGTGCGTGATTGGCAGCGGGCAGTCCGCGGGTGATGGAGAATGCGCCGCATCAAGTGCAGCGGAT
GTTGCACAAGTCGCTCTGAGAGAGAAGTAGCGTCGTGGTATGGCAACGTGCACGTGTCCAGCTCACTGAGGCTGACGCCCAGAGAGTAAATGTCCACTTT
CTCAGTGTATTCCTCGCTAAGCATCAACTCCAGCGCCTTCTACGACAGTGTGCCCGCTGCTCCGGTCGCTGTGAGATTCGTTTGGTCGTCGGTACCGCTG
CATTTGCGTCGACGGATACCAAAGACGCTCGGTTTGGAGTCCAGAGAAGACGAGAGCAACACGTTGCGAGAATTGACGTCCCAATGTAAGACCGTAGGCG
TCAACTCGTGCAAATAGACCAACGCACTCGTCACCGCCTGAGCGATGGCCAGTTTCTGCTTGGTCCATATGAAGTACCGAGTTAATCAACCCGCCCATGA
ACGAGCCCGAGAACGTCGCTGCAACTACCACAGTCCCAACCACTTGCGGCAGTGTTGTCACAACCCGCATTTACCGCCTTTTCAAAAGGCGCCTAAACTG
GTTTAGGCGGTGGGTTTAGGCGATACGGCGGCCGCTTCGCCTTATCGTTTCAGCGCCTTTTTACAATAATTTTGCTTTTGTATAGTATACATTGCTGCTG
GCAATCTAAAGCTGAGTCGCCCCCCCCTCACTAGAGCTGCAGCTCCTATTTAGAAGCTCGCATACAAGAACGCGTTACTACCCTCGCGTTCAGTCATCGC
TTCACCGACCATCACCACCGCTAGGCCTTCCCCGACACCCTCATAGACCACGTCCGTGCTGGTGTACGCAATCTCGGCGTCCGCTTTGTCTAACGTTGCC
CCAGTCTTGCCCGATCCGCCGCAGCGTCCGCATTCTCGTACGTTTACTGGCTGGCGTCCGTTTTGGTTCTACGTGCTCCAGTCTTGCCCGAAGCCGCCGC
AGCGCCCGCATTCTCGTACGCGTTCTGTTCGTCGGCTGTGTTGACTGTACGTACTCCAGTCTTGCCCGAAGCCGCTGCAGCGTCCGTATTCTCGCACGTG
TACTGGTCGGCGTCTGTATTGGTTGTACGTCCTTCTGTCTGGCTCGTAGCCGCCGCATCATCTGCATTCTCGTACGCGGTCTCGACGGCCGTGTTGAATA
GCGTTGCTGCCGCCACTGCCCGAAGACGCTGCTGCGGCTGCATTCCCGAGGAACGACTGATTGATAGAAATGTGCTAGACGAGAACACTGAGCAAGAGCA
TCGACAACAGTTTCAAGATAGCAAAAAAGCAGCCAGAATCGCATCTTAGACACAGCTCGCAAAATTTGCTGTCTATTACTACCGTCGTCTAATTGGTGAT
GACTACGACTGTATTCGCAGTGATATGATTGAGTGGATTGAGAATTCGCTGTCTTCCGCGCACCCGAAAGAGTTTCAATTTAATAAGGTTAAGTATTGGC
AGCATGTTAAAAAGGAAAACTAAACAAGTGCTGTACTTGACCTGGCAGTTAGAGTACTCTCGATCGCGGTTAATACTGCAGCTACGGAAAGGAAATTCAG
CGAGATTGGGGTGGTTCATACTCCAAGACGCAATAAGATAAAACCACCGAAAGCTCTAGACACACAGTGTATACGCCAATACATGCGTGAGCGCGAACAA
ACATCAACCGAAAGCGTGCCAACAATTTCCCGTATTATAGATTCAACAGAGCGTCCGCTGGTTGACAGATTCGTGCAAGATTAATTGCGGGTCGAGGGGC
ATGAATTGCCCGACAGCTGGTTCGCTAGCAACGCCGTATTAGCAACACCCATCTCGACTGACGCCCTCCCTGAAGCTGCACCATCTAGAACGCCTTCGCT
GCACACCCCAGCTCAACGTACGCCGGGTCGTACATCGCGAACCCCAATACGACGTTCTCCTCGTTTACGAACACCCACATCAACGCCAATCCGCCCGTCA
GAATACCTCACTCCACTGCGGTCGCAAGCCGATCAAGGGGACGAGCAGGCACCAGACGAGGACGACTTGAGCGATATAGGCGACGGCGTCGATGCAGAAG
AAACTTTTCCACACTGGGGAGAGTATCTTGAAGAAGTATTTGAGGATGCGGAGCTTGGTAGTAATTTCACTGAGTATTACGAAGACAGCCGTTTCCGCAA
TTGAGAGCTCGAAGAAATAACCCACACCCGATAACACTCCGTTTCCAGACACCGATGACCCCATGTTTCTGCAAGAGAGGAACATCCGAGGTATTTGCGC
TATGAAGTCACCACTCGCTGCTCTCTTCGCACGGTCAAATTCTCATAGCCCAATGAACTAGTTGAGCGTGTAACCAAATATGATTTCATCACCACCTTTG
TTTGCGTATCGACTGTCGAGCATTAAGTCGTAATCGACAGGCCTGTGCTATTACCATACGCACTAGCATTTGCTTCTCCAACGCGGACGTCAACTGGGCT
GTAGGTGCAGTGGGGGAGGTGGCTTCGGGAAGTGGTAGCACCACGTACACTAGCACGGACGCTGAAGAGAACACGTACGAGGATGCGGACGCTGCGACGG
GTTCGGGCAAAACAGGAGCGCGTACATTAATACCGACGTTGACGAGTCCACGTACGAGAATGCCGACGCTGCGGTGGCTTTGGGCAAGACCGGAGCTCGT
ACATTAACTCGGACGTCGACGAGAGCGCTTAAGAGACCACGTACGAGAATGCGGACGCTGCGACGGCATCGGGCAGTGGCAGCGGCACGCACACTAACAC
GGATGTCGAAGAGAACACGTACGAGAGTGCGGACGCCGCGACGGCTTGGTCAAAACCGGAGCGCGTACACCAACTCAGACGTCAACGAGAGCACTTAAGA
GTCGCTCTGACAGCGGGGCCGACGCACGAAGAGAAAATCTGTATTTTTTATGAAGGCTTTCTTTTGTTGTGAGGTTAACATGCTGCAACTAATTAGTAGA
AGATTAACTAAATAGTAGAAATTAAAACCAAGGCGTTTGGGCGAAAATGCGAGGGGTTTAGGCGAAAGGTCCCCGCCTAAACATTTCAAAAGGCCTCGCT
GCTTGCGGTAACATTCCGGAGACGGAGCTGGTGTGTCTTGCGATTGTGCTACCGAAGCTGTTGGCGTGGTATTGTTGACACGCTGCTGTGCTAGGAAGAG
CTGCAAGTCGCCTCCTTCCACGAGTTCCTGCACCATGGCCAAATGTTCCCACGTGCTCCACGCGATGCCGTTGAGAGTCACAATGTGCGGCTATTTCAGC
TGCCCCATGAGGTAGATCTTGGCCGGGAACATCTCCATCTCGTGTAACAATCGTCGCTTCTCCGGAACCTATTGTTTCAGTGTCACCTGCGTGTTGCGGT
GCAGCGCCAGACAGATCTCATCCGTCGCACCTCGAGACAGAGGCTTCAGTAGCTGCAGCTTGGCCATGGGGACCCGAAGACGACGGATCTTGCGGTGCGA
CTCGAACAGGCGGAAGCTCCGAATGGCCATCTCGTTCTTCCGAGCTGTAGCGTCCTTCTTCTCCTTGTCTTGTACACATGTCGATGTTGGTCTGTAGAGG
ATCCATGCGAGCAGTAGAAGCCAGAGGGTCGAAGGCAGACGCGGACAACCCGATCGTGTCGTCATAGTGCTCGAACGCTGCAGCGTTCTGGATGCCTTTG
CTGTAGCTCAACGACGTCTCGCAGTCTCGGATCGACGGCCAAGAGCTGTACGAGCTATCGTCGTGCTTCGTCTCGTAAGGCTGGTTTATAGGGGTAGACT
GCAACCGTAATGAATACTGTATTGCGAAAGTGACAATACAAAGTGGACTAGCAGCCCCTGTTTGTAGTCTGCTGCGTAGTTGGTGAGTATATGCCACGCA
GACGCCACGTCACTAGGTTGCGGCGAGCAGAGCTTAACCGGGTTCACGAGATGCAGGGATCAGTGGACACGGTGTGTAAGCCACTTCAAAGGCCGTCGTA
TGCGGTGCGAATTCAGATTAAGGTACCCGTCTGAGTCCATGTGGGCATGACGCTGCACTGTCACTTCAGGTTGCATATCGACCTCCCCAGACTGCCGCAT
TTGCAGGTGCCGAGATGTCTTCAGCTGCTTCTCCATTAGACTGCTCTCGAGAGCTGGGAGGCCTTGTAGTCGAGTGACCGACGAAAGGTCGTGCCGTCTG
GTAATATACACTCTCTCAGTTGGCAACCAGTGCGCTTAAAGGCCTTGGGAGGCACCACCAACAGTTGACAGCTGTGACAGGGATGCCGAAAAATAAATTG
GTGCCGCAATTATTGCAATAAGAAAGCATCAATTATCTATTGGAGGCTTTCTGGAGAGGAAGAACAATTAGTTTTTTTCGCTCCCGTTGTAGCACCAATA
ATCTATTGGGCGGTGATCAATCAGCCTTATATTATTCAGTACTTGTGCCCTCGCTGTGTACCAATATTGCTGCACCAATAATCTACTTTCTGAGCTGAGG
AGTTCAATAATCTATTTTGGTCTAGCCAGTTTTCTAACCCAATTATTTATTTTCTGCTTTGATTAGCAATAGATAAAAATGCAATATTCGGCCCCTCCGC
CATAGGGCGACCGCGTCGGGTGTAGACTTTGGCTACCGTGTGCGTGGGCGTCAAGACGTATCCAGCGTCCCAGAGGAAGGCTCGCTGTAGAAGACCAGGT
AAGTCGCCCCCATGAGAGCGTAATGGAACTCCGTTCCGTGAAAACACCTCTGACTGCTTAGACTCTTGGAAGGTAAAATGAAGATTGAATTATTTAAGTG
CTAGCGC