Description :
From Genome Similarity Track
Location :
Scaffold_96:23361- 24652
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.30Deoxyribonuclease ycfH

Sequence
1291 bases(100 bases per row)
CGTCATGATCCTGACTTGCTATGTCTGTCTGTGGAAAAATGTGTAGATGCCGAAGACCCGATGAAGCAGAGCCTCCTGTACAGCGACCTCGACTACGCTG
CTATTTGAAAAAGAAATAAAATATAGCTTGAGCTCTGACGACCTTGGAAAACCATGAATAAATACGTGGCTACTGCTCGCTTTGTGGCTACGCTTCAGTA
TTGACCAACATCATCCATTCTTCATTGACCCCGAATGCAGCCAGCGAGTTCTGGTACACTGCAGTCGCCAGGTCGACGAGTGGGAGCTGGCGAATCTCGG
CCGCACGAGCGTACGCTACGCTCACGAGAGCAGGCTCATTGAGCTCATAGGATGCCGCCAGTGTGTCCTCGAAGGAGAAATCGAAGGAACCGAACTCTTT
AGAGACCTCTTTTACCGCTGCGGCGAGCGGCACTTGGTCGGGGGCATCAGTCTCCAGCAGCAGCGTTCGCAGTGGGACCGCAGCGCAGCATGCAGCTGTT
TTACCCGAACGCGCATCTGTGAGCTGCTTCACATTGAGCGAAAAGTAGAGTTGCGTTCCCGTCGCGTACTTTTCCAAAGCGAGGAATGACTTCGCCAAGT
CAGCGCCGCCCGCGTACGAGTGCAACACAATACGAGGTGGCAGTTTCTTGTTCTTTGTGCTGTTCAGAGTCGCCTGCAAGATATCAAGCAGCTTCCCATA
GTACCCCACACAGTGGATCACGCACGTGCGCGAGAGCTCGATCGCGAGCTCGAGCTGCTCACGAAAGACTTGATCTTGCACTTGGAAATCGACTGCTCGG
CCTCGCGAGGACTTGCAGAGCCCAATCTCTCCGAGCTAACAAGACACACAAGAGCAGCAGCGCACATTTAATAGTAAGACTTCCATAGCACTGTGAACTA
CAAATCACATATGAGAACGTACGCTTGCGGTCGGATATTGCTTCAACTTGGCTCTGAGCAGCTCCAGGTACTCGTCGTGTCGCTCCTGTGCCCACCACGG
ATGCACTCCAAACGACGGGACGAGCTGGATACGACCGCTTGGATTCTGGTCACTAACACTGCTTTCTACTGCAGCTTTCGCATTGAACTCGCGGTCCCAG
TGCGCGAGAAGTGTCTCGAGCGCGTCCCAATCGCTTTCAAAGCAGGCGCAGGAGGCCACATGCGTCACGTTCGCAGCGACTGCGCGACGGATCACGGGGC
GCAGCGCCTCATACTGCTGAACTTGCTGCTGCTGGTGTGAGACGCAAAACCGCGGGTCGTGGATGTGACAGTGCGCGTCGAACAGCGCAGG