Description :
From Genome Similarity Track
Location :
Scaffold_1874:2336- 3729
Sequence
1393 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCACTTCACAGGGTGGTCCACATTCACAGCAAAATGCATATGACTGGCAGAAA
GTAACACCTTTCTACCAATGAGAGTCATTCATTAGATAGTGGTACTACCAGCCATCCGATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTAAACT
TAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCACTACACCTGGTAACACTTTGTAGT
CCGTCCAACGACCGACTAACACGTTCATATGGAATACGAACGCGGGACTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCT
GCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAA
CGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCC
ATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACT
GCCATTGCGGCTCGACGTATTGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCTAGGAGTTGGGCGTACGGACGCCGAC
TCACAGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTT
CCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCTAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACA
AAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAA
TGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAAT
GGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGC