Description :
From Genome Similarity Track
Location :
Scaffold_242:23359- 25931
Sequence
2572 bases(100 bases per row)
GGAGTCGAGGAAGACTCCCTGTTGAAATGTTTCCTCGAAGTGGAGGATGCCAATTAAGGCTCGCCACATCGACGATGAGGAAATACGAGTTGCATTTGCC
AAATCGAATTTGTCAGGGCGTGCCAGAAATTGGGCCCTGAATCTTCAATTACAAGATCCAAACTTGTTTGGATCGTTGGCGGTCTTTACGACTCTGCTCA
GCCAAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTTCAGACCTCCTGAAGATAAAACAAGGTAAGCATGACGTTCACGCTTACGTTCAGCAAGT
TCGTTACCTTGCAAGTGGCATGGTAGCAAACCCTGTAAGTGAATTCGTGTTGATCAATATCGATATTCTTACAGAGCCTCGTTTATGGTCTTGTGAGGAA
CCACCTATTCCGTATCGAGTTGAAGTCGCTTGAGGAAGCGATCACAACTGCGGTGTAAGAGGACTTAAGTGTGAGACAGGCTCACACTATCTTGACCCCC
TATCGTCCTTCAAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGTGTTCAGAGCGAGAGACCTCGCTCTTCAATCAGTAAGCGATTGC
AAAAGTGCAATCGCTGTCAGGACTTAGGACACTACGCCTACGAGTGTAGTGTTTCACACCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGTCTGC
CAAGAAAGGAAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGCGGACTGTACAAAAACGGTCGGGGTCAGTAGGGGCGGAGCGCCCTA
CTGATCCAGCTACCTCAATAGAATTTGCAAATCTATTGATGAAAGTCGCTCCAGACTCACAATCCTTGTGTGTCTCTGCAGTTGGTGACGAGTAGTACCT
CATCACCTTGAATTTAGAAGTGACAAAAGATTTGTCACTTGGTGCCTTAGTTGAATGTGGGGCGTCAAGCAATTTTGTTCGTTGCCAGTCGCTAGAGGAT
CGTAGGCTCAAGTTCGTTGAGCCGTTACTCCTCCTACGAGGCTGACGGTGCGCCTCGGAAAAGGCGCATCTATAGCAGTGATGAAACGTGTAGTGGGATT
TCACTACACGTTAGAATATTTGCAGTGCAATGATGATTTCATAGTACTTAATTTGGATGACAATTTTGATATCATCCTAGGGTTATCCTGGCTCAGAAGG
TACGATCCAAGTATCAGCTGGCAGCATCGAACCGTGGAGATGCCTGCCACTTGTTCATCAGATGGCCATCTGATGAACGTCTTGGAGCGTCCACAAGCGT
GTGGATGTACTGTGAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGTACGACCGCACAATATCGCAGTGTGACAACCAATCACACTGTGGAGGA
AGCTGCCGGCGGCTTTGCGGATGCACAGGCAGAGCCGAAGCTCCACCACTCGAACAAGTCGAGTGGAACAGGACATGGGTGTGCACCTAGCGGGCGACAT
CAAGTAAGAATAAACCGGTTGCCCACACAGGGCAACACGATGATCCTAGATAGGAGAGGATCTAGCTGTGGTAGCGCAACCACAGCTAGAAGACTTCGAA
GGGAAAGGCTCCCAGAAGCCTGTGTAAAAGAGTTCCCAGGAAGAAACCGGGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTAGACACTTATACAC
GTGATCTGATCGCGCCTCCGAAGTTGACTTCGGAGATCACTCAATTGACAACGCTAGAACCGAAACGGTTTTTGCGAGATCTGCGTAGTGGGAAGGTAAA
GTAGATTTGTGTACTCGTCACGAAGGACGAGTACGGGACTGACATTCGGTCGGCAGTAGTATTCGCAGAGAACGAACGGGTTCTCAGCAGATCATCGATA
GACGAAAGTGTCCTCGATGAGAAGACTCGGATTAAGGGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAACCCTTTAATATAAGGATTTGATCAAA
CTCAAGGACGTGTTCCCTGAATCCGTACCGTGCGAATTGCCTAAGGACAAAGGCACTCGACATGAAATCGAGCTCAAACCGGTCTCGAAGTACTGTGTCA
TAAAGCAGTGGCCACTGCCTCGTAAGAAAGTACTTGCGATCGACAAGTTCTTTGTCGATCGCTTGGCCGCGGGTCATGTGAGAGATTCAACGCCCCCTCA
CAGCTCTCCGGCCTTCTGTGCGCGCAAGGCTACAGGAGGGTGGCGGATAGTGCACGCATTCAACAAGTTGAATGCTACAACGGTACCGGCTCAGACGCCG
ATACCGAGGAAGGACGTATCATTGATGGTATGTCAAAGAGTACCATCTTTTCTTCCATGTATCTGATGGATGGCTTCTATCAGATCCTAATGCGTGAACG
GGACATCCCGTACACGGCAGTAATCACCCCGAGAGGTATGTTTTGGAGTAGCTAGTAATGCCACAAAGGCTTAGTAACGCCCCTGCCACCTTCAACAGAT
GTGTTAAAGATCTGTTGATACCGGTGCGAGCCTTCGCACCGAGTTACTTCGACGACGTATTCGTCCGTAGCC