Description :
From Genome Similarity Track
Location :
Scaffold_150:23354- 24436
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14762heat shock transcription factor
Sappa_CBS223.65SPRG_14763heat shock transcription factor 2, isoform CRA_a

Sequence
1082 bases(100 bases per row)
ATCGGGCACGAGCTGCACCATCGACGGCGTAAAGCCTGGCGTCTCGAGGAGCGTCGCGTTCGCGGCCGACGCGAAGAGCGGGCTCTTGTCCGTCGAGTAC
ATAAAGTGGTTGATCGCTTTCCACACGAGCTCTTCGTGGCTGCCCGGCTCGACCTGGAGGCTCGATGGCGGCGGCGGCGCCTTTTTTGCGTACGGCTCGA
GCTGCTTCCGGCGCTCCTTCTTGGCCCTCTTGAGCTTGGGGAAGGTCTTGCACTTGGGCTGCGGCGTGCGCACGATCATGTCGAGCAAGCCTGGCACACC
ACGCACAAAGCTCGCATGCGTATACGTCTCGACATCGTTCGCCTCGCTTTCCCAGTGGAAGCCATGATCGAGCAGCTGCTGGTGGAAGGCCGCGAGCTTC
CCGCGAAAGTACTTGGGCAGGACGGTCGCATCGAGCCGCTCGCGGTCGAGGATCGAGAACTTGGTGCCATCCTCGTTCCACGCAATGATCTCGGGGCTCT
CGTGGTCCAGGAGCAAGTACAGCTTGCGCACGAAGCCGCTCGCGATGTTGCTGCCCGCCATCCTCAGGAAGTCTGGCAATGGCACCATGCCAGCCTTGGC
ACGGTATCCGGCACGTTCCGGATAACAAGGCCCTTGCGACCAACAGAATGATGGTCAGACGGAGGCGCACGTGATTGGTCCAAAAATGGTGTTGACCAGC
ATTCGGGTATCGGCGACTTGATTTGCTGGCTTCTACTTCGTTAGCTTGGAGAAGAGGTTGGAGCTTGGAGAAGCGGCGACTCATTGCGGGTAACGTCTTC
TCGCCCCTAGTATCAGCGTTATAGCACTGGTCATGAAATCCCACTTGGTTTTATTCACATTGTCTGCCAATCAAAGAATCCAGCACAAGTGTTGATTACA
GTGCTTACGCTGCCATGGTGCTTGCGTCCTTCTCGCACAATCCTCTGTGGTGCTCCCCAGAATGGGTCGATGCTGCTTTTCGATATCAAGGGAAATCTCG
TGTTAAATAGCAGGGTTCTCAAATCGGGACATTGGACAGTACGGGACAGACTACAAGCAAGGTGGCGACGTCGCCTTAGACG