Description :
From Genome Similarity Track
Location :
Scaffold_89:233528- 235959
Transcript NameFunction/comments
Hyaar_Emoy2808847conserved unknown protein
Hyaar_Emoy2808848replication factor C subunit 4
Hyaar_Emoy2808849WD domain-containing protein, putative

Sequence
2431 bases(100 bases per row)
TCATGTTTAGCACCACGTCGACGTCTAAGGCTAACGCTCCCGCACCCGTGCTGCCCTGGGTGGAGAAATAGTAAGTGCTTCGAACATATTCTCTCCCCCT
ATATCTCGTACATACTCACTCGACCATATGCTTACTAATGGCTTGGTTGCTCGCCTCCAGTCGCCCTAAGAATGTGGACGAGATCTCCCATCAGACACAC
GTCGTGGCCACACTAAAGACATCTATCGCAAATGGGCAACTTCCCCATTTGCTTTTCTATGGACCTCCAGGCACTGGAAAGACGTCCACGATTGTAGCTG
TGGGGCGTCAACTCTTTGGCTCGGATTTTCGCAAGAATGGTCGCTTCTTAGAGCTGAACGCGTCAGATGACCGGGGCATTAAGGTGGTGCGGGAAAAGGT
CAAAAGCTTCGCTCAAGGAGCCATTAGTACCGCCAGCGGCCTCCCCCCTTTTAAGATCATTGTGCTAGACGAGGCCGACTCGATGACAGGGGACGCACAG
TCGGCATTGCGTCGCATGATGGAGAATTACTCTAAGGTCACGCGTTTCTGTCTAATTTGTAACTACGTGAGTCGTATCATCGAGCCCGTGGCCTCGCGAT
GTGCCAAGTTTCGCTTTGCTCCACTAGAGAAGGTCTCGATGACGACTCGCGTGCGCTATATCGCGACAGAAGAACACGTGCGTGTGTCGGATTCAGTGCT
CGAGTTGCTGCTCGAGTGCTCGAACGGTGACTTGCGAAAGGCGATAAATTACCTCCAGAGTGCCAAACAGCTCTGCGGGGATGAAGAGTTGTCGGAAGGC
GACGTCGTTGCGGTTGCTGGACTAGCTCCGCCTGAACTGCTGCAGCAGTTTTGGGCTTCTGTTGCTTCAAACAGCTTTGACAAGATGAAGACCGACATTA
CCAGCATTTTGCTAGCAGGATACCCAGTGCTGACAATTTTGCGGCAGCTGAACGATGACGTACTCGCACTCGAAAAGATCAGTGATGCGCAAAAGGCGAC
GATCTGTCTGCGCATTGCTGAGGCCGACAAAAAGCTTGTCGATGGCGCTAGTGAGCATTTCCAGCTGCTAGACGTCGCATCCCACGCTATGCGCGTCTAC
AATACATCGTAAAATACAAGTTGGTGTATCAACGGCTAAGACATCAGCTTAGAATAGAGGAGAAAGTGATGGCAATGAACACCTACGCAGTAGAATTGAA
TCTACAACAAAAACACTTGATGCCGTGGTGCAGCGATAATCTGCTCGCCCCTGCGTCAAGTAAGTAACTAGTTGCTCGAGATTGTGGCTGCGCCCTGACC
AGTTACGGAAGAAATGCGTGTCCATTCACGATTCTTCTGCTGCTTCCAAACAGTAACCTCGTCATCACCAGCTGCGACGCTGAGCACCGAGCCCGTGAGT
GACCAACTTATCCGGTACACTGGCGCACAAAACGTGTGCACCGCGTGGGACGACCATTCTCCACCGGCCTCATTCTGAGTCCAAACACGCACCGTGTGGT
CATCAGATCCAGACGCAATTACATTGGCAGGTAGACCGACATTTGGCGCCCACGCCACATCGCGAACCCAGTCGTTGTGTCCATACAAAGGAGTGTTTTC
GATTTCCCAGTAACAACTGCCAGAGGTCTCACCTTCTTCAGGGACAGAGACAATACGCCAAATCGTTATCGCTTGATTGCACGATCCAGTAACCACGCGC
TGGATCGGCCCGTGAGGTCCATGTGAGCCGAGCGAGTTGTAAGGTGCCCAGCTAACCGCCGTGCATCCCATGCCTTCCTCCGAATTGCGAAAACTCGACG
TGATCACCCACCCCTCCCGCATCCGGGTAAGGAACGACACCTGTCCATCAGCCGAGGCACTGGCTAGACTCAGCCCGTACTCGTACGGCGCCCACGCGAC
ACTCAGCACTGCCAGCGAGTGGAACTCGTGCACGTGCTTTAGACGCCACTCGGTCACGTTAGCAGTTCCAGCAGCCCCCTGTTGCACCAGCTCTTCCCGA
TAAATGTACACTTTTCCGTCTTGAGCTGCCAGAGCCAGCACTGCACCAAACTTCGGGTGCGCCCACGCCACTCGGTGGATAGGAGCGACCGAGTCGTCGG
CCAGACGCACCACATGTTGCAGAAGGTGCAGCGGCGTCGGTTGTTGAACGTGGTCACGGCTGTTTGCTGCTGTCAAAGACTCGTGGCTGTCTCTGTTGCT
AACTGCGAAGGTCTGGGACACGTCGTACACGCGCAACGTCCTGTCGGATGAGCACGTGGCCAGGCGCTTGCCGTAGTAATCGAGCTGAATGTCGTTGATT
GTGTCGCTGTGCTCCGTCTCGATGCTGACTAGTGGTGACTGGCGTTTTGGTGGATGAGGCGGAGGAGCAAACTGCCCGTCCACTGTCGTGCTGGAGAAGC
TGCCCGCGAGCTCCATTTGTGTCGACCCTCG