Description :
From Genome Similarity Track
Location :
Scaffold_57:233500- 237339
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16449pyruvate kinase
Phypa_INRA-310PPTG_16450hypothetical protein

Sequence
3839 bases(100 bases per row)
TTCCCATGCAAATGTAAAGGCCTCACCGCCTTCCTCGTTGTATGTTAATGCCGCTTCGCGGATCTTGGCCGTCACAGACGCTAGAATGTCGTTGTTCCGT
AGGTGCGAGGCTGCGTAGCTGCGGACAAACCTCTGCACCACCGAAAGCGTGGGTAGCGAGTCTTCGTCGAGGTTGAAGTGCCGCAAAACCCCGAGCGAAT
TATCGAAGGTTTTAGCCCTTGAGCCGCCCACTACTTTTTGGGGCAGACGGAAGAATAGTGTAAGTGTTGGTGTATTGATTTGAGTGCTGCAAGTACTGTT
TGGAAATTTATGTTGCTTTTTGAGTGCAAAGTGGACGTCGTCATCCTCGGCGAGACCCAAAATTGTTGGTTCCCATCCTCCGCTATGTTTCTGTATGGAT
GGGGGGTCATCCTTACTTTACTTCGATTTCTATGTTGAGGTGTACCATTACCCAGCGACCTCGTATACCTTTCAAACAACATCCGAAGGCAATAGCAACA
TAAAAATGCAGCGGTTATCACCACAAACACAAACGTGACATAAATATATAACATAACCGATATTAACTTTTAAAGGCATTCTCCAAGCACCAAAAACAAG
TGGCCTTCACCACCACACGCCAAGCAGCCGCCTCGTTGACAGGTAACCGTACACGCACCTCGTCAATGCCGTCCAACAATAACTCTTAACGTTCGGTCCT
GTGTATCATTGCAGACTTTCCCAGCTCGCACTGTTCGCTATCATCATGCTGCGTCGTTTTGCCCTCCGTTCTGTAAAGCCCTCTGTGCGCAGCTTCGCGT
CCGCCTCGGAGCTGTACAAGAATCCTCGCAGCTCCAAGTTCAGCATGACCAAGATCGTGGCCACCATCGGCCCCGTGTCGGAGCAGTTTGACATGCTGCA
GAAGCTCACGGACGAGGGCTTGCGTATCATGCGCATCAACTTCTCGCACGCCGAGTACGACGAGGCCTTGCTGCGCGTCACCAACCTGCGTGCCTGTCGC
GGCGTGCACGCTGAGGGCCAGGCCAAGTTCAACCTGCGTGCCGTGCTACACGACACCAAGGGCCCTGAGATCCGCACGGGTAAAATGCGTGATGGCAAGA
AGGTCAAGCTAGAGAGTGGCAAGTCTGTGGTGCTCACGACCGACCCGGCGTTTGAGCTTGAAGGTACCGCCGACAAGTTCTACGTTACGTATCAACAACT
TGCCGAAACCGTAAAGGTTGGCGATACGGTGCTGCTAGCTGATGGCCTTATCCGTCTCACGTGCACATCGGTGGGTAAGGGCGAGATCACGTGCCACATC
CACAATACGGAGGAAATCGGTAACCGTAAGGGTGTGAACCTCCCTGGTTTGATCGTCGATCTGCCTGCTCTTTCCGAGAAGGACAAGCGCGACTTGGATT
GGGGTGTCCAGCACGACATCGACTTTATCGCTGCCTCGTTCATCCGCAAGGCCAGCGACGTGAACGAGATCCGCTCGTTCGTGGACGAGTGCGTTAAGAA
GCACTGGGGTAACCAGCCCAGTTACATCGCCCCTAAGATCATCTCCAAGGTCGAGAACCTCGAAGGTATCCAGAACTTTGAGGAGATCCTTGAGGCCTCG
GATGGCGTCATGTGTGCCCGTGGCGACTTGGGCGTCGAAGTGCCCGCGCAGAAGGTGCTGACGTACCAGAAGATGATGGTGGACCGCTGTAACGCCGTCG
GTAAGCCCGTTATCGTGGCCACGCAGATGCTCGAGTCCATGCAGAACAACCCGCGTCCGACGCGTGCCGAGGTCTCGGACGTCGGTAACGCCGTGCTGGA
CGGTGCTGACTGCGTCATGCTGAGCGGTGAATCCGCTCAGGGCAAGTACCCGATCGAGTCTGTGGCCACTATGAACACGGTGATCAAGGAGGCCGACCAG
CTCCTACTCAAGCCCAACTACCAGGCCAAGTTCCAGTTCGACCCGCCCACGTCGGACGTCGAGTCGGCCGTGTCGTCGGCGGTCAAGACGGCCAACGAGA
TGCACGCGCAGCTCATGATCGTGCTCACCCGCACTGGTTACACGGCTCGCAAGGTCGCCAAGTACAAACCCACCGTTCCCGTTATGTGCTTCACCACGGA
CCTCAAGGTTGGCCGTCAGCTCCAGATCCACCGTGGCCTCTACCCGGTTGTCCCGGACTACCTCGACCGTGCCCCGACTACCGCGGAGGCCATCGCTCAC
GCCAAGAAGATGGGCTGGCTATCCGCTGGCAACCGCGTCGTCGTGATCAGTGGCGACAAGCTGTCGGACGACCTCGGCCGAGAAATCCTCATCGGCGTGG
CCGACGTCCAGTAACGACTGAAGACAAAACGACCTTGATACTCTAAAGCTTAGTTAGCGTATCAACAGGAATACAGTGTTTTGTATTAGAGTTGCCCTAT
TTTATTGTTACGGTTCCAGTACGACTGTTAGTATCCTGGCGCACTCTATCTCGCAACGATCTCACTTGAGCTCGAGGTTTCGTGACGCCGGTCTTAGCAG
AGGCGTCTTTGAGGATACGAGCGATTACTCCAGCTTGTCCTGCACCCGGCAATGCTTCCTTCAAGCTGCTCTCGAGCGCTTGGGTGCCCAGCAACTCACT
TAAGCGTTGGAAACTTGTAGTCGCCTCGGTTCGTGCAGTTGCGTCCTTGCTCTCACGGAATGCTGCCAGAGCGCGATACACAGCCTTTAAGGGCTCGCAG
CCTTTGTGAGGCAACGTCTGTTGGTCTTTCAGTAAGCGATCCAGGCTCAACGCTATGATCTTCGCAGCCGTGCCACACAATTTGCCGTTCTTGTTAGTGC
CGTACCGGGCTACTGCTGCTAGAAGCGGCATCCCAGCGAGGTGGGTAGCCAGCTTCTGTACTGCGATCAAGGCAGCATCGCGTAGGAATTTCTTCTCACA
GACAGATCGACGTAATAGCACGTCGATCATCTCTGGGCGAGCGCCACCGAGCAACGCACGCTCCTGAATCGACCGGGGCAGGAACTCGAAGCATTCGGCA
CATGCCAGCAGAGCATTTTTGGAGGGAGCCGATCGGAGACTGTCGCACTCGAGTGCGAGAGGACGGAGGAGCTCTTCGACCTGCTTGGTCGTGATCACTT
GGCTGTGATGCACGACGACGCGGCGCAACATCACGACAGCCTCGTACAGTTGCTGCCAGTCCGAACTCTTCGTCAAGACGTGGACGGCGTCATCCACTGC
GACGCTTGTGACGTCCGGTACGGGCGTCAACTCGTTAGTTGCGAGTACGACGACATTCTTGTCGTCTACAACTTCGGCGGCTTCGTCGTCGGGTAGCGAG
GCTTGACGGTGTTCTACTTCTAGACAGTCCTGCTTGATGGAGAGATCAGCGCCCGTCTTGATCTGAGTCATGTCCAGCGTCGAAATGCACGGATCGGCCG
AGAAGTGCTCGACGCGTGGAAACTTTTGCACTGTTCACGTTGCCAGATCCCCCGTTGCCACTGCCATCTTGGAGCTATATCGAGAGAAGACGTCATAAGT
ATTCGGGGTCGATAAGCTTTAGTTGAAGTGATAAAGTTAGCAAATCTTATCGGCAGGTGTAAGATTTGTGACTAGAAATGCACAGATTCATGTGCGGTAC
CATTGCAGTGCCAATGCAGCCCATGCTGCTTGACCTCCCCACTCGCATTACCTGCATCAGCATTATTTAGCGCTTGCTCTTGGCAAAGGTTAGCCTACAA
GCTTCCAACTGGGCGATTGATTCAGTTCCGAGAGCCGACACGTACCCTCGCGAGCAAGCAACTGAAATCGCCATCATTCCACTATTGCGCTGGGACCTGA
CCCAGCTTCAGCAACTTTGGCAATTCCTCCTAACTTAAA