Description :
From Genome Similarity Track
Location :
Scaffold_80:23349- 32479
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.4Protoporphyrinogen oxidase
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.5Protoporphyrinogen oxidase
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.35Dynein, axonemal, light intermediate chain 1
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.36Dynein light chain intermediate polypeptide
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.14Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.15Whole genome shotgun sequence assembly, scaffold_93, strain Mel28

Sequence
9130 bases(100 bases per row)
CACCCATCAAGCATGGCGGCGCTCGCGAAGCAGCCCGCGAAGGAGCTCGTGGTGCTCGGCGGTGGCATCTCCGGCCTGAGTCTTGCGTACTTCTTGCGCC
GCGCCATCCAGCAGCAGACGCAGACACAACAGCAGACGACACACATCCGGGTCGTGGAAGCCGCGGACCAGGTGGGCGGCTGGGTCCGCACGGCCAAGCG
TGACGACTTCCTCTTTGAAGAAGGGCCGCGCGGCTTTCGTCCGTCGCGCAACGGCGCCGAGATGCTGCGTCTCGTTGAGGAGCTGAACCTGCAGAGCGAG
ATGCGCGCGGTGGACGCGGCCGCCAAGTCCCGCTACATCCTGCGCAATGGCCTGGTCGAGGTGAGTTGAACGACTCAATTACATAGTATCACATGAGACT
ATCGACTGAACCTTGCTCTTCTGCGTATGGCTATACCTTTTTAGAAATTACCGTCGAGCATCCGTGAGATCCTGTCGTGGCCGCTCACAGCGGAGCTCAT
CAAGGCCGGCGTGCACGATCTCTTCACCAAGCCCAGCAGCGTAAGACGACATGCCCAACGCGCCTGCTTTCTCATGTTATGGCTCGTGGTGCAGCTCGCG
ATAAGTGTCTACGTATGCTAATCGCACGCTTGTTGTTGCTCCACTGTATGTCCACCGTGTTCACAGCTCGACGACGAGTCGATCTACGACTTTGCCGCGC
GAAGATTCAGTCCGCTCGTGGCGGAGCGGCTGCTGGACCCCGTGGTCTCGGGCATCTTCGGCGGCGACATCCGCCACCTCTCAGTGCGCTCGTGCTTCAA
AATGCTCCACGATATGGAGCAGCAAAGCGGCTCGGTCGTGCGTGGGATGCTCTTTGGGAAAAGTTCGGCGACCGACACGCTGCTCGACGGATCCGCCAAG
TCCGAGTTCATCCGCAACTACGAGCAGTCGGTCAGCGTGAGCTTCCAGAACGGCATGTCGTCGCTCATGAAGGCGCTTGCAACCGACATTCAGGTAGGTC
TTGAATGTCGATGTGTTGCTACTGCCGCCTCAATCTCGTTGCTGACTCACTTACACTCGAATTTGTACAGAACGATCCGCTCTCCGAGATCCAGCTCAAC
ACGAGAGTCGCCACTATCCACGCACACACCTCAGGCTCGTCTAGCTCTTCGTTTACAATCACGACCGAGAGCAGCAGCATCACTCCAGGTCCCCAGCAAC
AACAGCACCAAGAAGAGATCCACGCGAGCCACGTGTTCTCCACTCTGCCGGCGTTCCAGTTGGCGCCAGCAGTCGAGCAATCGCTCCCTTCGCTCTCCAA
GGCGCTGCAGGAGATCCAGTTCGTGCCGATGGGCATGGTCCACATCGGCTTCAACGAGAAAGTGCTCTCGAGCGACGGCTTTGGGTACCTCATCCCGTCC
TGCGAGGGTGAGAAGGTGCTCGGCGTGGTCTACGACTCGAATGCGTTCCCGTCGCAGAACGCAACTGGTTCCCACAATGCGCAGACCCGACTGAGCGTGA
TGTGCGGCGGCGCTCACTTTCCCGAGATCGCGACCATGGGTATGGACCAGGTCGAGCAACTCGCGCGCGACGCCGTGAAGCGTCACCTGGGGATCGCGAA
GGAACCGGACTTTGTGCGCGCCATGATGCTCCCGAACTGCATTCCTCAGTACCACGTCGGCTTCTGGAAGACACTTGAGCGCATTGAAAGCCGGCTGGCG
CCGGGGATGCGTCTCGGTGGCAACAGTTTCTACGGCGTCGGGCTCGCTGACTGCGTCACGCGCTCCAAGGAACTCGCGCTCGAGTACGCCAAGACGCTGG
CATGAGAAAATGCGCGAGTGAACAAACTGCGTGCGATATAAATTGGCTAATGAGAGATATGGCCTTGACGAATGATTCAAGAGAGAGAGAGAGAGAGAGA
GAGAGGTTTGTTGGTTGGTGTGATATTGTCAAAGCCATTTTCAAGGTCCTGCGTCTCTGTTTGTGAGGGCGATTGCCTATTTATACAGATGAAGGCGAAA
TTAGAGACGCGGCCGAAAGAGAACGAGAAACAAGCTCAAAGGAAACGGTTTGCTGCCTGCTGCCTGCTGCCTTTTCATCGAGTGTGCTTGTGCTTTGACC
AGCGTGTATGAGAGATAGGCATCGTCACCATTCTGCCGAGCTTCGTTCAAGCCAAATCTCGAGATGTCGCGCCTCGTGCCAACGCGCGCGCTGGACTCGG
TATATGGTACGAAGAGCTGTGCTTCTCTATAATGATCGTTATCTCACCCCCATCTAACTTGTCTCTCTCTCTCTTGACGTTTATTGCATGCAGACCCTGT
CTACACAGTGTCGAATTCCGGAGGCAAGTTCTCCAAGGGCGTGTATCGCGCTGGCGGCGCCAAGCAGCAACAGTCTGCCATCACGAGCACCAGCAACAAC
AACAACCCCTTGGAGGGCTACGCGATGATCAGTGGCGCCGAGCGCACCAAATTTTTTAAACGGCCCGTACTCCCGCATCTGCAGGCCGAGCTGCCCGAGG
TGCTGCTCGCGCCTGTTGCAGCAGCGCCATCGTCCACTGTGAAGAAGCGCCACATGCACAGCGATGACTATGACAATGCTTCGTCATCTGGAACGCGCTC
TGTGGGCATTCAGACCATGTACCGCGACTCGGACGCGCAGACCGACCCGTACACGCCGGATTATACGATCAAGAAGAAAGGCCCCGCAGGCACCGACGAG
AGCCCCGAGATCCTGAGTCTGCTACACTTGCGCCACAACAAGGGGCTCCCTGCAGGCCAGGCGGAGATCGAGCTAATCGAGCGCAACCGCAAGAAGAAAG
CGTTCGAGGCGTCGCTGCCGCCGATGACGGACGAGGCGAGTTTCCTGCTGCGCAAGGCCATGATGGAGGTACAGGAGAACCGCGAGTGGGCATACCGAGA
GGCCGAGATCGACCATCTGCACGAACAGCGCATCGCGTTGCTTAGGCAGGCACTCCAGGAGCGCGACCGAGAGAATGAGTTCCTCGCCGAGCAGCGTGTC
GAGGCGCTCCGCCAGAAGCTTGTGCACGAGAAGGAGAACGACATGGAACGCATCCAGCAGGAGCGCGTCACGTCGCTGCGCAAGCTCACGAAGAAGCGGC
AGCAAATGCAGCACGGCTTTGAGCATCTCACGGCGTCGCCCCCCAGTAAGCGTGACATTATCAACGAGTACTCAGATTTTGGCTCAAAGGTGTACGCGCC
AGTGACGCGCGATGGGAAATCGGGCAAAATCGACATCTTGGAGGTCGGTATTGGTAAACAGCAGTACAAGCAGATCGAGCAGCTCCACGAATTGGAAGCT
GCCGTGCCCGCGCGCATGCTGGTGTCGTCCAAGCTCAAGCCGACGGAGAAGAGCGTGCGCACCGCGAAGGAGCGCAAACAGGCGGCGGTGGAAGCGCATT
TGCTGAAAATGGAGTCGACCATCAAGAAGAGCAAGGAGAAGAACAGTGAGGACTCGTCGTTGATGCTGAGTCCTGGTACCAGTTCTTCATCAACAACTGT
CCCAGCTAGCTCCAGCCCATTAATGCGACGACGCAGCCAGCACCAAGCACAGATGATGACGCGTCCGCCGACACCCGACTACGCGCTGCCGAGCGACGAA
GACGAGAGCATGGCGGACGCCGTACGATTGCTGCAAAAGCTCATCAGGGGACGCGCAGTGCAGAACATGATGTTCGAGGGCAAAGAACGCCGTGCCGAGC
TCATCCAGGAACTTCGGGCGAGCGACGAAACCGCGAAAGCAGCAGCAGCCAGCGATAGCAGGAACAAGAAGCAACATCAGATTGGAGACGAAGACACTCG
GGTCGCGAGCTCTACTTTGACAAAAGCAGAGGGTGAAGTGGTCTCAGAGATGCTCGACTTCCTCTACAAGGAGCTCGATCGGTCGAAAGAGGTTGCCAAG
ATGCGCGAGTTTGTCGAAAAAGCAACAGACGAGCGGCGCAGAAGAGAGGTCGAAGAAGGCGGGCGGCGGCAAGCAGAGGATTTGCTCCGCGAGCGCGAGG
ACGAGGTGTTCCGGCGCATTGAGCGTGTGCACCAAGAGACTGCATCCGACTTCATCCAGGATATCCTGCGCGACGTGATCCAGGAACAGGCCCACGTCGC
GGCAATGGACGAGCTCGACGTGGTGGCGGAGGGTGGCGTGGCCAGCATCGTGACGCAGCTCGAGGCGACTTTCAACTCGGACGAGGTGATCGTGAAGGAG
CTCGTCGCGAGCTTCCTGTTTCCGCAGGTGCAGCGCAGCAACGTGTGCGCACAGGTGACGCAGGAGCAGAAGAAGTACGTCTCGGCGGCCCACTCGGTGC
TCACAGAGATGGTTAACCGCATGAAGTTATAGGGAGAGGCAGACAGGAAGTCTCTCGTTCTCTCAAGGTAGGTTGGGGCTAATATACTGCGATTTTTTTC
GATATGCACTTGGGGGAGTTCATCATGAAACCAATTTCAGATGAACCAGTAAGCCAATGTCCTACCTACACCACTTACTCACTTAGCACCAGAGGCAGCT
GATGCACTACCGGCACTACTGCTACTCCCGCCGCCAGCAGACTTGAGAAATGCGTCCAGGTGCTGGCCCTGATACTTGAGGAAGTCGATCTCCTCTTTGA
ACTTCTTGTCCTGGAGCGCCTTGCGCTCCGTCGCGCGCTTCTCGATGAGCTCGAGCTTGTTGGTGAGCTCGAGCACTTTGCTCTCGTGCTCTTGCTTGTC
GCGCACGAGCTGCTCGATGCGCTCCTGGAGATCGCCCATGCCGTCTTCGGCCTGCAACTGCTTGCGGATGCCGAACGTGATGCTGCTGTCGTAGAGCGTC
TTGTAGGCGTCCGTGGTGAGCCGGATCTCGTCGCGCACGCGCAGTAGCAGTAGCCCGCGTTCGGGACAGTTGATCGCCACCTCGCGGATGAGCTCATCGT
AGCACTGATGGTAGATGTCCTCGCGCACGGGGCAGATGCCGTTCTCGCGCGCCTGACGCTTCATGAGCTTGCTGTCCATCTCTTCCTGCAGCTTGATCAC
GTCGAAGCGGGTCGACGGCACAGGCGCCGCGTAGCGCATCCAGTAGCCCGTGTCTTCTTCGCGCCACATTCTGCGGTTGTGTCCAACATTTATGATCGAT
TAGCATATTCACATAGACCACAACCAAGCAGTCAATGAGAGAGGTGATGCGCTTACTGGGGAGGCAGGATCGCGTTGAGAATGTCTTCGATGCGGCTGAT
GCCGTCGCTTTTATGGGCCCCATCATCTCCAGATGAGGAGGTCCCAGCTCGCTTGGACGGATCCAGCGTCTCACCCGTGAAGATCGGGTCTCCGTACAGC
ACAAGCGACTCGGGGGGCGTAGGCGTAGCCATGTATCTGATCTTTCCACTCTATCAGTTCCCTTTTTTGTGTGTGTGTGAGTGCGCCTGGGCTTTGGGGT
CAATCACCAGTAGTCTCATGGGAGCATGAAACGACGCGACTTCTCATTGAGATGGATAGAGGACCAACGGCAATGTTCGACCATAGAAAGTATCTGTGTA
TTTAATCATCGCATGGAGCTTGAGGTTGACAGCAGAGATGAGAGCGTCATAGCATAGGTACTCCCGTGATGCTGGTTGCGACTCATCGTGGCGTTCAGCC
GCGCCGCCTCTTTTCCCTGACGCAGTCGCTCGTTGAGTTCGTTCGTGAGCTGTTCCGGGGTCTTGTAGTTACCACCGCTGGTGGCAGATTGCACCACCAC
TTTCTGCTTCCACTTGGAGCTGTTCACCTTGCGCTCGGCTTCGATTTTGAGAAACTGTACAGGAAATAAAGTGAGGGAGTATTTGTCCAGCGTCAGCAAC
ATGGATCTCAATAGAGTCGCTGAGATGAATGGGACGTACGTGTTGTTTCCGTGCGGATGGTGTGAGCTCGCTCGAGAGATTCCAAGGCTCGGCATCCCGC
AGATCCGGGTGGTTCGGTAGCTCTTCCGTGCGTTTGCCGATACCCTAACATAATGGCCACCAAACGAAGTTCGAAAGCAAGGTTAACCTTGTGATTCACA
GAGTTCTAGTTCCATTTCAGACGCACAGAGATACACAAACGCACGCACCTTTGCCATTCGCTCGTCGCCGAACGTCTCGCCGACGTACTCGTCCTTGAGT
GCGACCTCCAGGATTCCCATGTTGAAGCGGTTCATTTTGGGCTTGAGCGTCGGGTACTTCTTCGGGAGTTTCTCGGCGCGGAAGTTGTACACGTACATGT
GCGCTCGATTCCGCTGTGTCCATATCACACAAGATGCAAGCCAAAGTTGGAGATCAGTCGCAATAGCAACTTGCAGATCACTCAGAAGCTAGCTAGCTAC
TGTACCTCTGCGTTGACGTTGGTGCGCTTGTAGCACTTGCCGGTCAACTGCATGTTATCGTAGTTGGACGTGGACGTGTTCCAGCCGGGCTTGTCGCTCG
CCAGGATGCGTGACTTGAGACTCTCGAGCACCTCCTGCTTGGCGAGCGCCTTGTCCTTGGGCGTGTCATTCGAGCTGAACACGCGCTCGTCGAACGAGTA
GTTCACCGGTGCCTCGGTGCCTCCGATCTGCTTCTTCGCGTGCAGCACTGCGCGCTGTTGGGCCTGCTCCTCGCTGATGCTATCAGCCGGTGTGAGCTTT
AAGGTCATTTCTCTCTCTCTCACACACACGTCCACTGTGCGCTTCCTAGTGCTTGAATGGCGCGGAGGTCTTTATCTATCTCTACCCAACTCAACATGTC
AGCAGTATTTTACGAAAATAGGTGAGCATCTTATCACCGAGTTGCCCGAGCTTTTGGGCTTTGAGGGTTCTTAAATATGACCCAGCGAGAAACAGTTTTC
AGGAAAGGGGCCGCTATATTTATTTGGTGGTGCATGCATTTCACACTGCTAGACTTGGCGTGGAATGCCTTGGACATCATGCGAGGCACTTGTTGGCTTT
TCTCTCTTGCTTTCTCTCGGGTTTTCTTTTTTCGTGCGTGTATGCAGTTGTGGAATACTTACTGGCTCGTCACGGGACTGAGGCTGACGGGGTGAGTAAT
GGAGCCTGACTGACTGACTGACTAGGGTTTCTTTGTATCTTTGCTTCTTCGCTACGCGGACTCTGGAAGAAGCTGCTTGCCGTCGCGGATGCTGTTGCGC
TCCGCCTGCAGTTGGCGACAGAGACTTTCGAGCTTCTTGATTTTCTCCAGGTACTTCTGCGTTTCTTCTGCGGCGCGCACTTTCTCCTGGATCGTCGCGA
TCGCGTTCGTGTCGTACTCGGCGCACTTTTTTTTCATCGCAGTGTTCTCCTTCTCGAGCTTCTTCGTGTGCTTGGCCATCTGAAGTATCAAGGAGGTTAG
TTGGGGTTTTCAAACAGATGAGGGGCAATTTTAGAGTCGAGGGCCATTGAATCCATTCGAGAGAAAAAATTTATGTCAAGAACATGGTCGTACCTTGTCC
ATTTCGTCACGAAACGTCGTGAACATTTGGTTGCTCTTGTTGAGCGTTTCTTGGACAATGTCAAACTTTTCCGAGTATGAATTCAGTTGCGCCTAGTTGT
CATACAAGTCAGATAACAGCACACAAATCAGACCTTCGTGAGCATTCTCCATCAGCAAGCAATGCATTCATGCGATGCTATGCTCCCTTACCTGCAGCTG
CATCTCGCGGTCGGAGAACTCTTTCGCCTTCTCGAGCGCGAGCTTCACTTTCTCCGACTCGCGTGCCGTCAGTTCCATCTGGTGCGCCAGCTTGGCTTCT
GCGAGCTGAACCGTCAGGTCTTTCGCCTCCAGTTGCTTCTGGAAGTGCTCTTCCCGCACAGTGTACTGCTCCAGAAAGCCCTTGAGCTTTTGCTGAAGAC
TGGCAGATACAAACGCACAGAAAGGCAATGTCAGCTTGGTACTAAGGGGGACATAAAATACACAAGCAGAAGCAGCATGGACGCCAGCAGTGTACCTTTC
GTTCTCTCTGAGAGACGCGACGTAGTCTTTGCCCTGCTGGTCCATCTTCGCGCTCACTTCTTCAATCGTCTTTTGAAACTGAGTCGACAGATCACGTCTG
CAGTGGACAAGAGGGCATGGGGCATACACAAGTCAGTGGCATGTTAGCAACAACAGTAGCTTGGTAGTATAACCACATAGCTCATGCCTTCAAGCATACC
GTTTTTGATCCTCTTCATCGGCAATGCGGCGGCTCTCACTCTGTTGTTGGTGGAATACACATTGTTAGTTGCTTGGCTTTGTACCTTTCTGAACACTATT
TAACACAACACGAAAGTCACTTTCATACCACAATCAGCTTGTTCTGTTTCTGGAGTTCGCGACACAACTGCTCCAGTTTCGCCTTGGTCGTACTGGTTTT
CACGAGCTCCGTGGTGGCTGCACCAGGGAGAAATAAGATCATCAGATAGACACTATTCGATGAGCTCTGCACGCACAGACTCGGTGATGCACGAGAAGTC
CAATTTGCACGCACCTGCGTTCTTGCGCTGCTTGAGCAAGATGCACTTGGCGTTGATCTCGCTGATCTTCTGCTGCAACTGCGCCAGCTCGTCACTCTAT
ACAATTGAAGCATCTCGTCAGCATGAGCGGATTACGCCAAGCAAGGCAAATTCCGACATCTCCATATGGCTCTTAACGCACCGCCTTCGTGATTTGTGCT
GCGAGCGCGTCCGTTTTCCCGTCGGCGCTCATCTCGGTGTCTTCAAGCACGGTGTTCATCGTCGTCACGGTCTGCGCTGGTAGCGTCTCGTCCGAGAAGA
TCCCTATACATGCACACCCAAATCAGTCACTATTTCGCCATGCACTGTAGTTCATAGTCAAATGCCTGCCCTCACGCACCAGAGAGATCAATGGGGGTGT
CCAGGTCATCGCCGCCAACTTGCAGTTCCGCGATCTTGCTCGTGAGCAGCTCACGCATCGCGTCTTCGCCCTTGGACGCGCTGGATGCGTTACTTCCAGC
GCCAGCGCCAGCTGCTCCACTGCTGCTGCGGCCGTGGCGGTGAGCGTGGTGGTGGCGATGGTGGTGCGCGTGGTGGCTCTTGGTGTCCCCTCCAGTCGCA
TTGTCCGCCTGGTCGTTGTCCGCACCGCCAGTCGAGCCAGCACTTCCTGCCGCTGCCGCCGCCGCTGGGCGCTTGCTCTTGGACTTGTGCTTGAGGCTCT
TAGCGCTGCGGCCGTGCTGCTTGAGCTCCA