Description :
From Genome Similarity Track
Location :
Scaffold_204:23344- 25371
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_204-snap-gene-0.22GPI ethanolamine phosphate transferase

Sequence
2027 bases(100 bases per row)
GCACCACGGGCGACGTGAAGTAAATGTCGAAGATGCTCAGCACGTAGATGGCGTGGAAGACCACGCCCAGCACGAGCAGGCCGTGCACGTGGGAGCGCGG
CGCCGCGGCCATTTTGCGGAGGTGCAGCGCGCGCAGGAAGAGAGAGAGAGGGGTGTCGTCGACGGATCGGATTGCGGAAGGATTTGAGACCGTAGCTGCT
CGTGATCGGTCTACTATCGTAATTTGCTCTGGACAATGTGTCTATTTTCGTGATTGAAGCGTGGAATGCCATATTTAATATAGCTTGTTGTTTATGGAAT
GTAGCCATTCGTTTACACCTCGAGCGAGGGCGACGGCGACGGCGGCACAGCAGACGCCTGCATCGCCGCTGGCAGCAAGCGGCGTCGCGCCGCGTCAATG
TCGAGGCGATGAGACTCGGTGTGGAACGCAAACCACGTCGCGTCCATGCCGCTTACGGACATGGACGCCTCGGTGGTGGACGGGAGATCTTCTGGCGCCG
CCTCGCGCAGCCGCTGCAGCTCCGCCACAACCGTCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
CCCCCGTGCTGCGCTCGGTGCGACCAGCTCGGCGTATTCGGCCAGTACGGTCGCCATGTCCAACGCGCCGTTCGCGCGGTTCCGCTCAAAGTGGAATCGG
ATCTGCCGCGCATCGAAGAGCTCCGCATCCGATGCCGAGTTCGCCATCAAGTCGCTGGTCTGGCTCGCAATAGGAACAAACGTGAGCACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAGTCTTGCCAGAACCGCTC
GGGCGGCGCGGCGCCCTGGGCCATCTCCCACACGACCTCGTCGGCAAAGCAGCCCGTCTTGTCCATGTACTCGCCCAGCTGCGTGAGCAGCGCCTGCCGC
GCTGGCGACGTCACGGAAGGCTCGAACGTGGCCGGCCAGAGCCGCGTCGCGACGGCGGCGACAAGCGTCTTGACTTTGCGGCGACCCGTGGGCGAGAAGC
CGGCGCCACGCGTGCGTGGGTCCAGCAGGAACGCAACGAGGTGGTGGTCCTCCACGGCTGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGGCGGTCAGCACGGCGTCGGCCAGCGACGTGCGCTTGGAATCCTCTACGAGCGGCGACTGCTCGATGGTCGCGACC
AGCCAGAGCCAGCAGACCACAAACTGGCTGGCGCACACGCTCTTGCTCTCGCTCAGGGCAAAGAGCCACGCAAACGGCGAGAGCAACTCATCGGCCGCAG
AGAGGTCCTGCCACAGTGTCACCTCCGCCTCCAACAGCCCCGCAGAGTCNNNNNNNNNNCCCTTCGTAGAAAGACTGATGACACGCTTGACCACACGGAA
CGGCAGGCTCCACGCAGCAGCAGAAGCGAGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCGCTGTGAGTTG
CGGCACGGCGTCCGCCACGAGCGTCCATACACCGACGGTCTCTGTCAACAGGCACCTACTCACGAGCGTGAGGCGGCTCAGCGACGATGCTTTCGCGGCG
GTGCGTTCCGCACGCACGTGGTCGACGATGTGGCGCGCGTCAGAGCAAAAGCCCACGACGGCGTCGGNNNNNNNNNNCATCTCAGCTTGCCACGTGTCCG
AAGCCCCCGAGGCGTCGGCGAGCAGCATGCTGTGGCGGCTGCGGTCGGCGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACGCGAGCGTGACGCTCTCGCTCTGACGCAACCAGAGCTGCTGCTCC
TGCGCGACTGACGCCGCCACCGTGTCC