Description :
From Genome Similarity Track
Location :
Scaffold_86:23343- 28911
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.5IDI-7
Pytve_DAOMBR484maker-pve_contig_86-snap-gene-0.40Transducin family protein
Pytve_DAOMBR484fgenesh_masked-pve_contig_86-abinit-gene-0.75Conserved gene of unknown function

Sequence
5568 bases(100 bases per row)
ATGAGTTCGTTCAAGAAGGAGCACCCGTTCGGTACGATCCTGTTGTTGTCGCGACCGTTGATGCGGTGGAGATTTGATTACTAACGTGGTTTGCTTGGTG
ATGACAGAGAAGCGCCAGGCAGAGGCTCAGCGCATCCGGTCCAAGTACCCTGACCGGATTCCGGTGCGTGGAATCTTTTGTGCTTTATGGAGACGGAATG
ATGGACCGTTATTAACGAAACGGCGTATCGTGCAGGTCATTTGCGAGAAGGCGGACCGCAGCGACATCCCGGACATTGACAAGAAGAAGTACGTTCCTGT
ATTGAGCTTGGTGCTTTGTCCTCGCTGGTGCTCATTGGAGTGATCTTGTTCTCGACAGGTACCTGGTGCCCGCGGATCTGACAGTCGGCCAGTTCGTCTA
CGTGATCCGGAAGCGCATCAAGCTGAGCCCCGAGAAGGCCATCTTCATCTTTATCAACAACGTCCTGCCGCCCACTGGTCGGTGACTGCAATGAATGGTT
GGAGTGCTTGGAACAGGTCGCTAACGTGTATGATTGTGTAAACCCTTCAGCCGCTCTGATGTCGAACATTTACGAGGAGCAGAAGGACGTCGACGGCTTC
CTCTACATCACGTACAGCGGCGAGAACACGTTCGGCCACTAAGATCGACCCGCCGAATTGCACAATTCGGGCGTGGGGCGGTTTTTGGTTGGCGTGTTTT
GATGTTTCTCCTTTCAACGCGACTCGCGTGGGAGCTCGAGGCGCCGACACCTTTCGTGGCTGCGGCCTGTGGCGACGTGAGGTTCGATGTCGGGACGACG
ACTAGCAGGAGCACAATTGTCAGACTGGACGCATCGTCGGTGATGGCTCATTATGGAGCTTGAACCGGAAGCGTCGAGGACGACAGTTGGCTTGGATGCT
GGTCAGAAGTTCCGGTCGGCGTCGGGGCGAGCAGCGGTGAGACGATGAGCGAGGATAGGAGAAACAAGAGTATTTGCTGCTGCGTGTTGGACTTTGACTT
TCTTCGTCTTCTCGTGCCTCTGGCATGGAGTAGGAGGGTTTGTGTGGATAGGACAGTGGCGACGACTACGTGACAGAAAAATCACCGGAACGGAATACAG
TCGATCGCTATTTCACTCACATCTAAGCTTGCGGTGCGTGTTCGAACTCGAAGGTTTGAAGTCCCTGGCCGACAACAACCACCATCTCTCGTGGCTGTTG
GTTGTCGACATTTCCTTCTGTGTGCCGCACTGCCAAGTCGGCGATGTCGGCACACTCTGAGAACGATGCGCACTGCCATTCAAGTGCCATCATCGTCGCC
CCATCTGCCTTGTCCTGGTCGCGGTTTCGATGGACACGCCACATGCTGACGCGCTGGTCGTATCCGCCGATAAAAACCGCATCCTTGACGCTCGCGATCG
CCTTGATGGCCGATCCAGACGCGTTGACGGTGCGCACGTCAGCCTCGACTTGAAACGTCGAGAGGCTGATCTCGCACAGACGGAGGTTCTGATCGTCGCC
GCCACTGATGAGGGTGAACACCTCGCTTGGTCGATCGCTCTGCACCAGCGCCATGCAGTTCACGCCCATGTCGTGGGCCAGGTAGCTTCCTGCCCGAGGC
AAATCGCGAGCCATCGCTTGAAGTCGTGAGATCGCCTCGCTGGTCGGCTCCGGCAGGTTCGCGACCAAATCAGCCACCAAACCGGTCAAGTCGAAGAGCG
AAATGATGCCATCGGTCGAACCGACTGCCAAAACTGCTGTGGAAACACAGCCGTCCTCTCTACGCTCGCGCTGGAAGCCGACACACGACAGAATCGGTTT
CTTGGACAGCAACAGACACTCACCGAGCTCTGTCAGCTTGCCGAGTGCCAAGTCGAGCAGCAGCAGCGGCATCGCACCCTCCGAGTTGGCCGCTACGACG
AGTCGGTAGCGCCAGTTCAACACGAATGTTGTGATGCCGAGGATCCGGTGGTCCTGCAACGCGCCGCGCGGCTCATAACCACAGACGAACTGCAGTTCAT
TCGCTTGCTGAGGACGATCGCTGACACGCCAAATGTTGACTCTTTGCTTGCCACCGCCCGAGATGATGATGGTCTCCTGCTCGCCGAGTTGGGTATTGCT
ATCGATGACTTGCCGTCTGAAGGACGTCAATGCGCGGACAGTGGTCGTGTGCGCGACGCCCGACGAGACGCCCGCCCACCGCTTGTTGGCGCCAAAGCTC
TGTCGGCGGTGCAGCTTCAGACTGTTGTCTTCGGCAGCGGTTACGAGCCGATCTTCGTCGATGAGGACAGAACACGTCGTCATTTTACCGTGGTAGCAGT
CCAGCAGCGACAATTTCTGGATATTGGCGCTGCTGGAGCTGGTGGAGTGCACCGAGATCTGCACGGTTGAGTCTCCCTTCTGCTGCGTCGGTGGCGCGAA
CAGGAACGTGTGCAACGGGAGCGAAGACGACGCACCGTCCTGACTGCTGTCTGGCGATATAACCAGAGCATGAGGCCGGCGCCATCCGCCGCATTCGACG
TTAAACACCCGGTACTGCGCCGACAGGTTGTACAAGATAGCCTGTGTCGAGTGGAAGCCCAACACCAAGAGGTCGCCGCGCGACGAAGGCGAACTCGATG
TCTTGTGCCAGAACAACTCCTTGACAGTAGTCATCCCCTTGATCGACTCGCGAGCGATAGGCTTTACAGTGATCGCGCCAGTGAGATTGTCGAGTTCACC
CCACGGCTCCACCAGAAACGTACAAATTTGTCCGTCGTGGCCACCAGAGTAAAGTCGTGTGGCGTCATTCTCAAGGCTGGTCCCGTTCAGAAGCAGCGTC
GACACTTGTTCGCGTCCGTGGACGGCTTTCAGCACCACGGCAGGCATCGTGAGCTCTGTTGGAGCGGTCTGAGCCTCCGAGTCGAACTCCAGCGAGCGGT
GGAACACGAACACGTTGCCGCGACCATCGCCGCAAATGATGTTCCGCGTGGCTGCATCGCGATCCAACACGACGAGCGCCGTTGTGCTGCACTTGCCCGG
ACTATGGAAGCTCGCGATGAGCTTCATATCAGCCAGCTCCTTGTTTTCAGCACCTGATACAGGCTGGAACTCAGGCCGCCACTCGGTCAGCGTACCATCA
GCGCTGCTGGCAAACACTGACGACTCATGCCACCAGATCTTCATGATGCGAGAGCGATGACGAGCCGTCCACGAGTAGACTAGCTCTCCTGTGCGGCTTG
ACACGACAAAGACGCGCCCGACCGAGTCGCCAACCAGTAGATACCGCCCACCCTCACTCAGTGAACACGCCGACAAGCTGCCAGGACTGCTGGTCGCGTT
CTTCGACGACGAGTCGATGGGGATAGAGAAGAAGCGTGCAACGTCACCATTCGCCACCGTCGCCTGAAAGATCTCGCCGTGCTCAGTAGCCACGAACGCC
GTCGCACCGTTGTCGATAGTGTTGGCGACGATGGTTCGCACGCTGTTGGTGATCGAGGCCTTCTTCTTGCCATTTGTTGCGCTAATGTCGCTATTCACCG
AGGCATCGATCGAGATCGTCGCGAACTGCGGTGCTCCGGTCGACTGGACCTGTTGTTCGACGTCCCAGAGCTTGACGGCGCCGTCTCCGCCGCCTGTGGC
CACGAGCGACTGCGAGGGATGAACGGCCACTCGCCAGACATGCTTGCCCGTGTGGCCCTGCAACGTCGCGATGCACTCCCCATCCACATTCCAGAGCTTG
CACACGACGTCTTCGCTCGTGGTCGCAAGCCCACCAGCACAGAACTGAACGTCCCAGAGCCGAGCCGTGTGGCCCCACGCGCGAAACACTGGGCGGAACT
TGTTGCCGAGCAGCACCTCTCGGGTCGTCGAGCCAATATCCTCTTCGCTGGATGAGTTCGTCCACAATTGAACCGTTCGGTCGTCCGACACGGACGCGAG
CTGTCGTGCGTCTTCAGACCACAGCAGCTTGAAGATGACGCCTTCGTGCGAGTGCAGGCGCTGGGACGGCGCCACCTCGTCGCTCACTGTGGACGATGCC
ATCGGGTTCCACAGGAGAATCTGTTGGAACACAGTGCCAGCGGCCACCACGACCTCGTCGAGGCGGCGGCCGTGGAACGCCAGCGAGTACAGGATGCAAC
GCTCAGCGCACTGCACAGTCCGCTCGATGGCGTTCCGCTCCGGGTCCCAGATCTGTACAAAGTTGTGGGCGAGTCCAACGGCAATGCGCGGCGTGGAGTC
TTCAGCCAATACGATTCTGACATCCAGCACCCAGTCACTGAAGGTCTTGGGCTTGCCCAACGGTTTCCAAACATCTTGATCTTCAGCCTTAGCGGCCACA
GGCAGGTTGGCAAAGCACGCCACGCGCTTCTGTCCGAAGAAGGCGCCGAGCTCGCTGGTATTGCCGCCGTAGCAATCGCTGCCGTGAAGGATTCCTCGCG
ATAGAACCTGCTGCTGGCCCACGAGTTCGCCCGAGGCTACGTCGAACACGAAGACCGTGGCACCCACGCCAGCGTAGAGCAGCTGTCCGCCTGGCGCGAA
GCGCAGCAGCGTCACGGCGCCGAGGAAGTCGTGCTTGACAGCCCGCATGATTGCCATCGCTGCTTTGCTCGGGAAACCTATGGCCATCAAAATGGACTTG
GTTGGTATACCGGTTTATACCGGTGTGGTACATGGCTACATTTTGTGCCACGTCAAAGTTGAAGTGGAGGTTTGAGCAAATGCACACCTCAAGCTTGCAT
ACAATGCTAAATCGCTCACAGCCATGACTATATACATCATAGCAGCAATCGCACCAGCTTTGTGTATTCATCGCCAAGTGTGTGGAGCACAGACAATCAG
GCAGTGATCGACGCCCTGCGCTCGCCCAACGCCCCCGCCAGGAGCAGGGATGCCCTGCGACCGAACAAACCGATCAGCGGCGCGAGCGAGAGACCGCGCA
GCAGCTCGCGCTCCCTCGACTCGCGGTACTCGTCGTGCTCGCAGCGCTTGGAGTAGACCGGCGTCTCGGCCTGCACGACCTTCCAGATGCCCTGACGGCG
GCGGAACTCGATCTTGCTCTTCGTCGGGTCCGAGATCGGCGCGAATTTGTTCGGCTGCAGCGCCGCGGCGATCGCGGCGGGCGTCGCGCCAGGGTGCGAG
ATGCGCGCGCCAGTGATGAGGAACTCGCGCACCCGCGTGAAGACCCGCTCGCTGCACTTGGTGCACTTGGGCACGGACGAGAACGTGTGCGCCGCGAGCA
GGCACACGAACTGGTGCAGCTCGGCGCGACGCTCCTTGATGACCTTGGCTCGGCGCGCGGCCAGCACCTGCCGCTGCGGGAAGCGGAAGTAGCGCAGCGC
CTGCGCGAACCAGCGGCAGCCGAAGCACTGGAAGACGCGGATCCCCGCGAAGAAGTCCACGAGCTCGTCGCGCAGCGCGAGGAAGTCCGAGTACCGGCGC
TCGACGAGCCACTCGAGCTCCGTCTTGACGACCGAGCAGCGCAGCACGTACGCGGTCGCGCCGTGCGCGCCGGTCTTGGCGTCCACGAGGCCCACGATGA
GCTTGGGGGCGAGGCTCCCGGGGCCGCACGTGATCACCGAGAACGAGTCGTCCGCCTCGGGCTCCATG