Description :
From Genome Similarity Track
Location :
Scaffold_121:23341- 25154
Transcript NameFunction/comments
g10449.t1hypothetical protein

Sequence
1813 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCAT
GTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCATGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGC
AAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAATTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGT
ACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGC
TCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTT
GTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGG
CGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATAGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTC
GCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAGCCAGCAGCTGTCGCACTCGAGAGGTCCATT
GGTTCGGGACCTCCCGACGGTCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTG
CAAGCGCAATTGCGGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCCCTAAGGCCCTTCATGAACGTGACGACCTTTGT
CGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGCAAC
TCCGCCCTCGATCGGAATTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTC
GGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGACGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGTCGCAATGGCAGT
GTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAACTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGC
GACATCGAAGCTCAAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCTAGAGCAACACCATGTTGCTCCATCGGCGATAGCGTTCGCAACATCGTTG
CTACCGCCGCTTCTTCAATGACTGTTGACAGTCGTTGATGGGCCTCCCACTCTGGTTCGAAGGGGGGCAGTCTGCAAACGCGCAACATGCGCTTGCAGAC
GTGTTTTGGGCTACCCACGACATGTTATGTTACGAAGGGAGGTTCTCAGGCGCCCGCGTTGTATTCATACGAAGGTGTTAGTCGGCTCGTTGGAGCGGAC
TACAAAGTGCTACCAGGTGTAATGGGTTCTGCTTAGACCACTACTATAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGATAATTGTACTTAA
GTTTTAGTATACT