Description :
From Genome Similarity Track
Location :
Scaffold_2227:2334- 3813
Transcript NameFunction/comments
Phyta_totarag14269hypothetical protein PHYSODRAFT_517749

Sequence
1479 bases(100 bases per row)
ATGCTCACGATTGGGTCCCTCGCGGTTTCGGCTCTGGCCTGCGCTCTCCTGTCTTTGAAGGTCGATGCTGACTACACTGTCAAGGCTGATGCCGCCACGG
CGGTGCAGGGCTCATGGGACGGGTGGGGCACGTCGCTTTCCTGGTGGGCCAACGTCTTCGGAGAACGCGCGGACATCGCCGACGCCCTCTTCACGCTGAA
CGAGACTGTGACACTGGacggtggtgctgcatcGGGGATCCCAGCTCTTGGATTTAACATCGCGCGCTACAACATCGGCggctcgagcagcaacgttgTT
GATAACAGCGGTACGGAAGTCGCGATGAAGACGTCGGAGAACATGCCTGCGTTCAAGTTCATGGAGAGTTTCTGGCTGGACTGGATGAGTAAGGACCCGG
CCTCCACGAGCTGGAACTGGAAAGCGGATGCCAAGCAGCGTGCAATGCTTACACTCGCCAATGCGCGTGGAGCCAACGTGCTCGAAGCGTTTTCTACCTC
GCCGCCGTGGTGGATGACGTACAACCGCGCAACTGCGGGCGGAGACGACGGAACGAAGGACAACCTGCAGGAATGGAACCACGACGACTTCGTGCTGTAC
TTGGTTACAGTGGGTAGGCCAATGCAGACTGGGGTATTAAGTTCACGTTCGTTGAGCCGTTCAATGAGCCGTCTGAGACCTGGTGGCAGTATTCACTTAA
GCAGGAAGGATGCCATTTCTCAGTGGATACTCAACAAACCATCCTGACGCTCCTTCGCAAGCAGCTTGACGCACTAGAGCTGCAAGATGTGGCTATTGAC
GAGAACTCAGCGACTGAGTCGCTGTCTACGCTCACCACTATGTCTACCAACGCAGACGTCATGGGTTCTTTCGAGAAGGTGAACACTCACGGTTACGAGG
GCCTTGAAGCGTATCGCGGCCCAGACCGCGGTGGACTGAAAGATCTCGCGAACAAGCTGGCCAAGAGTCTGTGGGACTCTGAATACGGCGAGAACGACGC
TACGGGACTCACCATGGCCGAGTCTATCGGCCTCGACATCAACGAGATGGGTGTGTCGGGCTTCGTGTACTGGCAGGCGCTGGACAGCGTCGGCTGGGAT
CTCATCCAGTCCAACCCGGCCGACAACTGGGTCGGTACGCCGAACCCCAAGTACTACGTGTTGGCTCAGTACTCGCGCCATATTCGGCCCGGAGTGACGA
TTCTCGCCACGGATGACACGAAGACTGTCCTGGGCTACGactcggagaagaagctgctggttgccgTGACAGTGAACACAGGTGATACCCAGACGGTCAC
GTTCGACCTGGCGAGCTTCGCAACAGTTGCCGGCCCCATCAATGCGTGGACGACCGAAACAAGTGGCGAGGGAGCATTGTACAAAGCAAGCACCGTCGAC
CTCTCGGGCACGTCGTTCAGCGCTGTTTTCCCTGCGAGATCAGTCATTACGTTCGAGATCGAAGGAGTTACCCTAGTAG