Description :
From Genome Similarity Track
Location :
Scaffold_23:233390- 234799
Sequence
1409 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AGATCGTCCTCACGCCCGGCTCGAAATATTGCGTGTCGCGACAGTGGCCGCTGCCACGAGATCAGGTCCAAGTCATTGACAAGTTATTCTAGAGTCGCGG
CAAGGCGGGTCGCGTCCGTGAAAGTACTTCGCCAAATTCCAGTACGACGTTTTGTGTGACGAAACCCACGGATGATTGGCGTACGATTGGCTTACGTTCA
TACTTTCAACAAACTAAACGGCGCAACCATTCCAGCCTAGACTACGATTCCTCGGAAGGACATGGTACTCGACGCCATGTCGGGTAGCGAAGTGTACAGC
GCCATCGACTTGACCGATGGATTCTATCAAATCCACATGAGGGAGAGCGACATACCCCTCACGGCGGTGAGTACTCCCAGCGAAACGCTCTCGGAGTGGC
TTGTCATGCCAAATGGATTGAAGAATGCCTTAGCCACGTTCAATCGCGTGGTATCCAATGTGCTGCGCCTACTCCGTGATTTTGCTCCGAGTTACTTCGA
CGACATCTTTGTCCACAGTCGCGTTGAGAGCAATCTCAGCGCGCCCGAAGTCCACTTGAAGCATTTAAAGCAAGTCTTCTAAGTGATGCGTGAAAACAAG
CTGTACGCGAATCTGAATAAGTGCATCTTTTGTGCGCCGGAGATTCCGGTGCTTAGCTGTTTCGTGAGCAAGGACAGCGTCCGAGCCGACCCCGAGAAAC
CTGCGCGTGGCCCACACCACAGAACCCCACTGAGTTGCGTCAGTGGCGGGGTCTGGCGAATTATCTTCACAAGTACACGAAGGACTACGCCGGACTGATC
CAGCCGCTTGCCTCGCTGTTGAAGAAAGACGCGGTATGGTCGTGGACTCTAGTGCACCAAGGCACCTACGACTCAGTGAAGAAAAACCTGGCAGAGGCTC
CTATCCGTGCTTCCGGATGACGCGAATCCTTTTCACATCGTGTGTGAAGCGAATAACTTCGCCATCGGCTGTGCACTGATGCAATTCGACGATGTAGATC
GGGAATGAGTCGTGAGTTACCAATCCAGGCAGATGAAGCCGGCCGAGAGGAATTACCCGGTTCATGACAAGGAATTCCTCGCGATGAGATACGCTCTGAT
CACCTTCAGAGTGCTGTATTTACTAGGTGAAAAGACCTTCGCGGTTTATACCGATCACGCATCACTGAGAACAGCGATGAAGAGCCCGCATCTGTCCCAC
CGGATGGCCCGCCGGCTCTCGTTCTTCTCTGGATACAACTTCGTTGTCCACTACAAGTCTGGTAAGAACAATATTCTCGCCGACGCTTTGTCTCGGTGTC
TAGACTACG