Description :
From Genome Similarity Track
Location :
Scaffold_23:233381- 234800
Sequence
1419 bases(100 bases per row)
CCACGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAGATCGTCCTCACGCCCGGCTCGAAATATTGCGTGTCGCGACAGTGGCCGCTGCCACGAGATCAGGTCCAAGTCATTGACAAGTTATTCTA
GAGTCGCGGCAAGGCGGGTCGCGTCCGTGAAAGTACTTCGCCAAATTCCAGTACGACGTTTTGTGTGACGAAACCCACGGATGATTGGCGTACGATTGGC
TTACGTTCATACTTTCAACAAACTAAACGGCGCAACCATTCCAGCCTAGACTACGATTCCTCGGAAGGACATGGTACTCGACGCCATGTCGGGTAGCGAA
GTGTACAGCGCCATCGACTTGACCGATGGATTCTATCAAATCCACATGAGGGAGAGCGACATACCCCTCACGGCGGTGAGTACTCCCAGCGAAACGCTCT
CGGAGTGGCTTGTCATGCCAAATGGATTGAAGAATGCCTTAGCCACGTTCAATCGCGTGGTATCCAATGTGCTGCGCCTACTCCGTGATTTTGCTCCGAG
TTACTTCGACGACATCTTTGTCCACAGTCGCGTTGAGAGCAATCTCAGCGCGCCCGAAGTCCACTTGAAGCATTTAAAGCAAGTCTTCTAAGTGATGCGT
GAAAACAAGCTGTACGCGAATCTGAATAAGTGCATCTTTTGTGCGCCGGAGATTCCGGTGCTTAGCTGTTTCGTGAGCAAGGACAGCGTCCGAGCCGACC
CCGAGAAACCTGCGCGTGGCCCACACCACAGAACCCCACTGAGTTGCGTCAGTGGCGGGGTCTGGCGAATTATCTTCACAAGTACACGAAGGACTACGCC
GGACTGATCCAGCCGCTTGCCTCGCTGTTGAAGAAAGACGCGGTATGGTCGTGGACTCTAGTGCACCAAGGCACCTACGACTCAGTGAAGAAAAACCTGG
CAGAGGCTCCTATCCGTGCTTCCGGATGACGCGAATCCTTTTCACATCGTGTGTGAAGCGAATAACTTCGCCATCGGCTGTGCACTGATGCAATTCGACG
ATGTAGATCGGGAATGAGTCGTGAGTTACCAATCCAGGCAGATGAAGCCGGCCGAGAGGAATTACCCGGTTCATGACAAGGAATTCCTCGCGATGAGATA
CGCTCTGATCACCTTCAGAGTGCTGTATTTACTAGGTGAAAAGACCTTCGCGGTTTATACCGATCACGCATCACTGAGAACAGCGATGAAGAGCCCGCAT
CTGTCCCACCGGATGGCCCGCCGGCTCTCGTTCTTCTCTGGATACAACTTCGTTGTCCACTACAAGTCTGGTAAGAACAATATTCTCGCCGACGCTTTGT
CTCGGTGTCTAGACTACGA