Description :
From Genome Similarity Track
Location :
Scaffold_46:233346- 235944
Transcript NameFunction/comments
Hyaar_Emoy2806134translation initiation factor eIF-2B subunit epsilon

Sequence
2598 bases(100 bases per row)
AAACGAGCAAAACAGCCAATGGATCTCTAGTCCAAGCCAGTCTGCTATCATGTGTCGGCAAATTCGCTGCAGCACCAGCAGTCCTGCGCGGTATACTCAA
TCCAGTCAGCCACACTCATCGTAGCGTACACGCGCTGCGAGATCATAATTGTTCCGACCATGTGTCCCAAAAAGATTCACAGCAGCCTTGATCAATCCAA
TCTAGCATCCACATTCCCGCTCGACGGTAAGTTTAGTCCAAGTTGACACCGTTCAGTCTGCCTGACTCACCGAGTCGATTAGTGACCGTGGAACTCGTGC
TGCCGTGATTACTCGGAATTTTAAATCGAAGCACGAGAAACTGCAGTCCTCGTCGGAAGCATGTGTGTGTAGGCGTTGCATCACGGCACATCGCACCGTA
AAACTGTGAGCCTCTACGCACTGCACCTAGTGCGGTTAGGTAAATTCATCTTGCGAAGATGATTAATGAGTTCAACAAGCCCTGAACGTGCGAAGCGACG
CACCAACAAGCGGCGACTTGAAATACTTGACTAAGTCGAGGAAGATTGGTCATTGCATTGGAAAAAACGCATCGTCTGTCAACCCTTCAAAAATATTCAC
ATTGTTCTCACCATACACCGCAGAATCTAGAGGCCAGCTCATAGCGTTCCCTCCTGTTTGCGGAGGTAACTGTTGTGGAAGTTGGCCAAGTTGCGGAAAA
TGTTGCGGGGTAGGCTGGAATTGATGTGCCGGCAGCGATTGCGGCATAATACTTTGAGATGATGACGCCGGTGTGTCAACACTTGCTCCATATCCGAAAT
TGTTTGACAGCATAGATGCTCCAAAATTGGTTCCGTTCATGGACCCCATCATCTGATGTTCGTGTTGCTGCATGGGCATGCCCATCATACCACCCATAGA
GTACCCAGATGATCCGAAATTTACATCAGAGCCGAATCCGAGTGGAGCAATATATGGATCCACCGGAAAGTTGCTATCACTATTACTATTGCTGCCATTT
CCACTGCTGTATACGTTTGTAGGTGCTGGTATCGTAGGCATGCCATAATTATTGTTATCATACATATTTCCACCCGCCAGGTTCATTGGCATCGGCATTG
ACATAAACTGCTGCTGCTGAAGGTTCATCATACCGCCGCCCATTACATAGCTTTGCTGGTTCGTAAATCCTGCGGACAAGCTGGGAGGTCCACTTGTGGA
AGTCATGTACACATTTGACGTAAGTGTGTGGCCAGTGGAGCTCATCGAGTAGCCTAGGGCCGATGCTGCTACACCAGAGGCTGCCATCGACGTGACTGAC
GTGAATCCAGCCGACGTTTCCATCGAATCCATCTGTCCCGAGGGAAAAAACATACCTGGACTCGTTGACGTAAATCCAACAGGCATCGGAGGGTCAGGAA
ACATAGTCGGCGGTGTCGGTGCAGCCGTATGCGACACCGTCATCGCCGTCGACCGCGTGCATGCAGGGCGTATCGGAGTCGGCGTCGTCGAAGCCTGCCG
CGGCGCGTACACCGGCCGAGGAGCAACAGGAGTCAATTGCTCCTGAGCATGTGAAAATGCAACACGACCAGCTGAAGACGCCGGTTTCTGCGACGCCTTT
GCTTTTCTTGAAACTGCTACCGAAGAGGAAGCGGCTTGTCTTGAAGCTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTACGCCTGATGTCACACTGC
TTGTGATCGCGCGACGCCGGGCGATTACGAGCGGCGGGATATCGGTTTGTCCATACGCATGAGGACGCAGTGCCGCGACCCGTTTTATAAATGAGAGTAG
CGCTGCGACTGCGATACGCCCAAATCCTGGGGAACCCGGGGCTATCAGCGAAGCCAGTATCTCGAGTCTAGCTCCAATCTGCTTACGATATGTTACACAC
CTCTTCACCCACTCCTTGTGCTCTGCAGACTTTGTCTTGGCAGCTGCAAAGACGCAAGAGTCCAAAAATAATAAAACACAAGAAAAAAACGCCCAACACA
ACACCAAACAGTCAACACCGCATCCTACAATCATTCCAATCGTATCCACGTATTTCTCCGACGTACGCTGTCGTTTATGCAGCGCATTCCAGCCCCTCAG
CGCCGCCTCATTTTTCTCCAACATCGTCTGGATCTCTCGTTGTGAGATTGATCGACTTGGACCCCACAGCGCCTGAAAAAGGTAGTGCATTCCACAGTCA
GTGAATATCGTTAAGTAACATCTACGGCAGGTATAAGCAGGACGACTAGACCGGTCCATTCACACACCTGGGCAGCGGCAGCCGCACGCTGTTGCAAAGG
ATTGAGATGCTGCTCCCTATATGATACAAGAAAGCAATAGATACACACAACAGGTGAGAAGCTGGCGATGCAGTAGCAGCGCAGAGTCACGTACGGCATC
GGGAAGGACGCCATGCTAAGGGATTACTACTGGTATGGAATAAGTACTGACCGCTCAGCCAATCACAGGGCAGTGTGATATTGTTTTATTCACGCGAA