Description :
From Genome Similarity Track
Location :
contig_119:2333- 4378
Transcript NameFunction/comments
g13869.t1RAW24820.1 Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Phytophthora cactorum
g13870.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
2045 bases(100 bases per row)
TCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGG
GACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTG
TATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCC
TTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCG
CACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTG
AGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTATGATGGAAGGTATGGATC
TTGACACCGTGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAA
AGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGC
CAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGG
ACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAATACCCTCAATACGCCCCCTCAATGCGAAGTCCCATGAATGCC
GAGACCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTGGTCATGATGTCCGCCAGCATCACAGAAGTCTCGCAATACTCGAGCTTCACTTCAC
CGCGTTTCACTTCGTCACGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGGGTTCTTGGTCATCTTGATGCACGACTGGTT
GTCTTCACGGATCATGAGCTCGGGTCCGGTTTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACTTGCCCTCTTGGATAGACAGACTG
AGCGCGATGTACTCCGCTTCGCTCGTAGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATCAGCATGAACGTGTAGCCTG
AAGTGGACTTGCGGTCGGCGAGGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATCTTGTCGCCCGGCTTGAAGCAGATGCCATGCGTCTT
GGTGCCTTGCAGGTAGCGAAAGATGCTTGACCGCAACCCAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTC
AGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTC
ATGTCCACCGGACTCACCACAGCCTTGCACTTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGT
GACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTG
CCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGT
TTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTAT