Description :
From Genome Similarity Track
Location :
contig_119:2333- 4378
Transcript NameFunction/comments
g11316.t1hypothetical protein
g11317.t1PREDICTED: copia proteinlike putative

Sequence
2045 bases(100 bases per row)
TCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGG
GACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTG
TATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCC
TTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCG
CACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTG
AGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTATGATGGAAGGTATGGATC
TTGACACCGTGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAA
AGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGC
CAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGG
ACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAATACCCTCAATACGCCCCTCAATGCGAAGTCCCATGAATGCCG
AGACCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTGGTCATGATGTCCGCCAGCATCACAGAAGTCTCGCAATACTCGAGCTTCACTTCACC
GCGTTTCACTTCGTCACGGATGTGTGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGGGTTCTTGGTCATCTTGATGCACGACTGGTT
GTCTTCACGGATCATGAGCTCGGGTCCGGTTTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACTTGCCTCTTGGATAGACAGACTGA
GCGCGATGTACTCCGCTTCGCTCGTAGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATCAGCATGAACGTGTAGCCTGA
AGTGGACTTGCGGTCGGCGAGGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATCTTGTCGCCCGGCTTGAAGCAGATGCCATGCGTCTTG
GTGCCTTGCAGGTAGCGAAAGATGCTTGACCGCAACCCAGTGTTCCTCTTGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTCAG
GGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTCAT
GTCCACCGGACTCACCACAGCCTTGCACTTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGA
CCACCACAGGGTGGTCCACATTCATAGCAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCA
GCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTT
GGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATAC