Description :
From Genome Similarity Track
Location :
Scaffold_32:233295- 237146
Transcript NameFunction/comments
Hyaar_Emoy2804858predicted protein

Sequence
3851 bases(100 bases per row)
AGGGAAAGAGGGAGAAAACCTCCTTCTTTGGATCCGAGAAGTCGAAATGGCGATGAGAGACGCTATGATGAAACCGAGCGGCTGAGAGTTGGCCTGGCCA
TTTCAAAACTTGGTGGTGGAGCCAGAGAATGGGCTCTGACATGTGATACGTCTGCAGATGCTGCATTTCCAACGTGGGATTTGCTTAAGAGACAGATGTA
TCACGTGTTCACACCGCATAATCAGGCTTATTGAGTGCGTTCACGCTTCTTATCCTCCCTACAAGGGAATAGGTGTTATCGGACTACGTCCAAGAGCTGA
GAACATTCTCGCTGCTATGCAGTTGGATTCTCTTCCCGAGGTTGTCCTTGTGACCATTTTTATGGAAGGTCTCCATACTGGGATTTATCGGACAGAAATG
TTTCGTGTCCATCCCTCGACCTTTAAGGGAGCGGTGGAAATAGCGTTAGACGCCGAGTTTAACTTCAAAGCGGCTCGCTATGGTACGCACGGGCATGCCC
AGAATTCGTTTGATAGGGCTGAGACCATGGATCTCAGTCATGCGGATGATGAAGAAGCCTAGCTTCAAGCTGTGGAACAGCAACGTAACATTCGTAGATT
TTTTACATGTGTGGAGACGCAAGACATCTCCGCCCTAACTTTCCACCGCGCAATCCACGACAAAATCGGCCGAGCCGTAATACCGCTCCAAACCAGAAAC
CTGGTACGGCGCGGGAAAACGTCGACTCCCTGTAGGTGCGGGGCGCCCTACTGGGAAAGAACTAGGATTTGAAGAGGCTCTAGGAGGTAGAGCTGAAAAG
GCTTAGCCCCAAACGACGTCATGGACGTTACCACGAAGAGTGAATACAAGTCAAGCTTGGTTGCTGCCTCGGCAAAGATAAAGGGCTTTGAAAAGCCGTG
GTCAGTTTTTATCGACTCTGAGGCATCGGGCAACTACTTCCGACGCCGTTCTGTTGAAAGGATTCAGCAGTATGCTAGGGCACTGAAAGCGCATGAAGGT
GATTTATCACGGTGCGTCTATCAACTGAGGCCCGCTTCACCGTTTCTAAAATTCCTTTGAACCTGGATGTAAAGTTTTTAGACTTCGACAGCAGTGAACG
CTGTCTTGTCCTAGATTTGGACTTGAGATATGATTTCATCCTCTGTATGGTCTGGCATAATTTGATTAGAGGTCCAAGAACTTAGGCGCAACGCGCGCTG
TTTCTAGTGAGACTTTTGAGAGTCATGAACCCGCCTTGCTAGACAACAAAAGCGCTATTGGTGTGAGCCACTGACTGAGTCAGTTAGTGTTCTGGACATC
GGGATGTCTGATATACTCGATTCTGATGTCAATGACGATAGTGGGACGGCACGTACTCCGTTAAGTGGCACTCGTTTTTACAGCGAACCACTGGATACTG
ATAGCATTGATGACCCCAGGTCGAGTCATTTAGATTATTATCCCTTAGAGATACGTGCAGTGGCACGAGAACATCCACAGAGTGAGGGAGGCTGTCATAG
CACCTCACTGAATGTCGGTAATGACATTGTTGGCGAGACGCTCGTACATCAATAGTTAGACTCCCCTGATGTACGTGCAGTGGCGGATAACTCGCCGGGT
AATAAGTTCGAGTTTAGTAACCATGCACCGGATGTCTGTGATGGAATCGGCTCTTGTATAGATCAAGCTAAGGTTGAAAAATATAATCACATTGTAGGAC
CGGATGTTCCTTCCTCGCCAAAGTGTTCGGTCTCTTTGCAGAGACAGCAGCGACGCCAGATGTCTGCTGCGAGACGTAAAGCGTCTGTAATATCGCTGAG
AGATACTAGCTATCAGCTATATACACTGGTCGATGGAGTGGCAGGTCACGTGGATGGTGAAGCTGACCATGCATTCCCCCCCACCGTTAACTGCTCTCTT
AGAGATAAACGAAATGTCAGTAGGTGAGTTCAGTCATACATTGAATTCAGGCGACTTATCCGATATGGTGGTCGTTAGACCCGATCCTGAGTTGAACTCC
TCGTCTCTCTTCAATGAGACGGTCCTTGAAAGTACAAAGGCGGCACTTAGTGCACGTAGTGGATCATCCATTGAAAAGAATCCGTCCCTACTATCCTTTG
GTTTAGGAATTTGAAGACGTGGTGTGTCATAATCCATCATCTTTCCTACCTCCCGATAGAGGCGTACGTCATGAAATTGACTTGGTTCCTGACACCAAAT
CTACGTTACACAACAGTGGCCTTTACCAAAGGAACAATTTGACGTCATTAACTAGTTTTTCAGTGCTAAGCACGCGGCGTGGAAATTTGCGTGAGAGCAA
GTCCCCTCATTCTACACCGACATTTTGTGTCAAAAAGCCTGATGGTAAGTGGCGTATTCTTCATGCTTATAATAAGCTTAATGCGGCCACTATACCGGAA
CAAACACCCATTCCTAGAAAGAACGTTCTTCAGAACAACATGGCAGGATGTACAATGCACAGTGCACTCGACCTGGTCGATTATTATTATTAACAGCTCA
TGCGATCAAGTGATATCTCGATCACAGAGGTTAGTACTCCAAGCGGTATGCTTTAGTAGTGGCTGGTTATGCCCCATAGGCTTTCTACTGCCCCTGCTAC
ATTTAATCATCTGGTGACGCAACTGTTTCACCCTCACCGTGCTTATGCACAAACATATTTTGATGACATATTCGTCCATAGTCGGGCGGAACAGGGTCGT
TTGGACGTGGATAATTACATCGAACATTTAAGAGCTGTGCTCGAGTGCATGCGCACTAATAAACTTTAGGCTAATGCATCAAAACGCATCTTTGATGCGG
ACGAGATCCCATTTTTGGGATGCTATATTGGGAAGCGAGGTCTCCAGGCGGATCCCACAAAGGTAAATGCCATAGTGGATAGGCCAGTCCCAAATAACTA
AAAGGATCTACGCAAGTGGCTTGGCCTTGGCAATTACTTGCAAAAGTATAGCGAGAATTACACTGATATGGCTCGGTTATTGCCCAATCTTCTTAAAAAG
GATGTGGAATGGTGCTGAACTAGCACCGCAGGAGAGGCTTTCAAGGCCGTAAAGGAGAGTCTCCTACATGCTCCAACTTTGGCTCCGCCATATTCTGATC
GGCCTTTCAGTTTCGTCTGTGACGCTTCGAATTTTGTCATTGGCTGCGCTCTGTTACAAAAAGATGTTGAGGGACGCGAGCGTGTCATCGCTTTTGAATC
CCTTCAGCTTAAAGCTGCTGAAAAGAACTATCCATCTCACAACAAGGAGATACTTGCTATGAAGTATGATCTTGTCAAATTGAGAGTTCATCTGCTTGGC
TATAAGCCTATTCTAGTCTATACCGATCATGCGTCTTTACGCCTGGCGACCCAATCGCCTCATCTCTCGCAGATGATGGCCCATTAGCTTTCATTCTTTG
AAGAATATAACTTCGAGGTGAAGTATAAGCCGGGGAGGCAATAAAGTTGGATGATGCGTTGTTACGTCGGCCTGACTATGAGCTTGCTCATGTTACGATT
ATTTCATCGTCAATTACTGACTTAATCCGTGCATCTTATGCTAAGGATAAAGAATGTGTACCTTTGCTGCGAGCTCTTGGAAGCGATGTGCTTAAAGACT
CAGACATTAAATTGTCGGTACTTCGCGTGCGAGGCTACATCGATATTCTATCGATATCGGCTTGTTGTGCTATCGCACGGATTCTGTGGATATCCCGTGT
ATCATTGTTTCTTATGATGAAGAACTGAAGTATCGAACTCTCTATGAAGTTCTCGACACAGCTATTAGCGGTCATCTCGGTCGTAAAAAGACCTACGGCT
TCGTTAGTCAGAGTTATTGGTAGACCAAACGGTATAAATAAAATGCCATAT