Description :
From Genome Similarity Track
Location :
Scaffold_10:2332889- 2335856
Transcript NameFunction/comments
Physo_290406high mobility group protein putative
Physo_357626phosphoglycerate kinase

Sequence
2967 bases(100 bases per row)
GCGCCCGCCCTGGCGCTGGGGATTTTGCTACTCGGCAAGTGCCGTCACTTGTGATTGACACCGCCGCGCTTCGGGCCCCGAGGAAATCGCCCCGCGTATG
ACGTACTGCCATGGGAGCGGGGCTGCTCAAGTCGCGCGCGCGCGTCAATCGACCGCCCACGGAGGAGGAGGGTGCTTCTCACTTCTTGTCCTTGCATTGT
GTATCGTAACGTATCCTTCCCCTCATATAATTTTCCCATTTGCAAAAACGTCTTCGAGTTGCGTTGCGTCCGTCCTCCACTTGAGCGCTAGAAGATCGGT
CTGCGGCCGCCAATCGAGCCCGAAGGCCAAGGTATCAGCGGGCCCGCGTGAGGACACCTCGCGCGAGTCAAAGACACGCCCCGTTTGGCGTTATGTCCAC
GACGCGTTTGCTGCTTGGCGTCGAGGACCATCGCCACTTGCGACGCCATCCATTGCCGACGACGACGGCACAGCGGCCAAAGCAATGCTTTGGCCAGTGC
TTTGAAAGCATTGACGCCCAAAGGCTCGGCTTGGATCGCGTTTAACTGCTCGTGCTGTGCTGCACGGGTTCGCCCAACAAGCGGGCAATGCAACGCTCGG
CCGTCACCGGGTTGAGTTGGGAATGCTATGTATTTGTTGCGATTAGATGGCACGAGAAACACTGACTACAGCCCGCTCCTCCTGACCGAGGAAGCGGTTC
ACGCCGACGAGAGGGCGTCCACGCCGGGCAGCACCTTGCCCTCCAGGAGCTCCAGGCTGGCACCGCCGCCCGTGCTCACGTGGCTGACCTTGTCCTCCGT
GTTGAACTTGACGCAGCACGTGGCCGTGTCGCCGCCGCCGATGATGGTGGTGGCGCCGGCCTCGGTGGCCGCGACCACGGCGTCCATGACGGCCTTGGTG
CCGTGGGCGAAGGCCTCGAACTCGAACACGCCCATGGGTCCGTTCCAGACGACGGTCTTGGCCTTGGTGACGGCGGCCTTGAAGGCCTCGCGCGACTTGG
GGCCGACGTCCAGGCCCATCCAGCTGGCGGGGATGCCCTCCTCCTGGGTGGCCGTCTTCTGGGCGGCGTCCGGGGCGAACTTGTCGGCGATGACGAAGTC
CACGGGCAGGTGCAGGGTCACGCCCTTGGCCTTGGCCTTCTCCACGATCTGGGGCACGATCTTGGCGCCCTCGGCGTCGTACAGCGAGTCAGCGATCTCC
ATGTTGTTGATCACCTTCTTGAAGGTGTAGGCCATGCCGCCGCCGATGACCATCTCGTCCACCTTGTCGAGCATGTTCATGATGAGCTGGATCTTGTCGG
CCACCTTGGCGCCGCCCAGGATGGACACGAAGGGGCGCTGCGGGTTGTCCAGCGCCTTGGCGAAGTACACGAGCTCCTTGTCCAGCAAGAAGCCGGCGGC
CTTGACGGGCAGGTCCACGCCCACCATGGAGCTGTGCGCGCGGTGGGCCGTGCCGAACGCGTCGTTCACGTACACGTCGCCGAGCTTGCTGAGCGAGGCG
CGGAAGGCGGCCACGGCCTCGGGTGAGGCCTTGACCTTGTTGCCCTCGGCGTCCTTGCCCTTGCCCTCCTCCTCGACGTGGAAGCGCAGGTTCTCGAGCA
GGATGACGCTGCCCTCGGCCGGGTTGGCGCACGCGGCCTCCACCTCGGGGCCCACGCAGTCCTTGAGGAACGTCACCTTGCGGCCGAGCTTCTGCTCCAC
GGCCACGGCCACGGGCGCCAGCGAGTCCTTGGCCTTGGGCTTGCCCTCGGGGCGGCCCAGGTGCGACATGAGCACCACGGCCTTGGCGCCCTGGTCCAGC
ACGTACTGCACGGTGGGCAGCGCGGCGTCGATGCGCTGCGTGTTGGAGATGGAGCCGTCCTGCGCGAAGGGCACGTTGAAGTCCACGCGGATGAGCACGC
GCTTGCCCTTGACGTCCACGTTCTTGACGCTGAGCTTGGCCATCTTGACAGAGGGAGGAGAAGAGAGGAGAGTGGGGGTGTTGTCGACTTCGAAGCGAAT
TCGAGAATGAGATCTTCTCGGCTTGGCTCGAGGGGGTCAACGGGCTTGACTCGTGAGGAATCTTTGCATGGGTCGATTGCTTTTTGCCACTATTGCACCA
CATGGTCGGGCGTCTATGGCTACCTGGTAGCTTTTTTGCCAGGAAGAAATGATGGTAACGTTACACTTTTTCTTCATGTATGAAGTCAAGACAGCAGCAG
CAGTAGGAGAAGTGGCGTTGGCGATGCGTTTTTCGAGTGTGTGTACCGATTTTCCATGCTTACGCGGTGGAGTTGAACGGCAGGGACAGTTGTCGAAACT
AAGCTTACGGCCAGAATTGTGTAGTGTGTCTTGTGAACGGAAAATTGTGTTTATGATAGATGAATGTGAACGGTGCGATGAATAACTTACCACAGTGTCA
TAGGCTCGATTGCTATTCCAGTGTTGTCCAGCGCCTAACGTAACGACAAAGTCAGCTGAGGAACGCCACTAGAGTTCCGACAGACAACTTATGTGTAGTT
TTGAAGATGCCCTTCGCATGGTGGGGCACAACGTTAAAATTAGTTACGAATTTGAAGGAGCAGTGTCATAAAACACTTTAATTTCAATTGGTGGTGGTGG
TGCAAGCCGCGTTGTCTGTTTTACTAAAGAAATACCGCCTCGATCGGGCTCAAGACGGGCACCAGTAAGTGTGCTTCCGGGTAGTCACGGTTCGTCCTGC
CATTGACGCGCTGGCGTGGCCGAGCAAATGTAAAGATACGCTCCATACTTTAATCAAGTGATAGAGAAACGGAGCCTGCGCGTGTCGCACAGAGCGTGAC
GTACGTGGCCGGCCGGCGTTGCAGTCGATTGCACAGTGCCAATTTGCCTGCTCTGCGGCGCGGTGGAAACCAGGACTTCTTCGGTGGAGAACCATGCATC
TGGCTGTGCGTACGTATGGCGCAGCATACGGATCTGTTCGCGTGTGTGCTTTTTGTTGATGTCTTGG