Description :
From Genome Similarity Track
Location :
contig_188:23324- 25477
Transcript NameFunction/comments
g14146.t1hypothetical protein

Sequence
2153 bases(100 bases per row)
GACAGTCTGGCCATTAAGGCTGGCTTGGACGCACTCGACAACTCCTCACTCGGACGCCGTGACAACTTCGAGCTCAACCAGGATGAGACATCGGCCGTAA
TACTTCGCTTTTTCGCCTCTTTGTGAAGACAAACAGGGACACACCATCCCGCATTGTTACCGGAGATTACCGATGGCTCGTCTTCATCTACAAGCACGTT
TCCTCGACCGTCAGTTGGAACGCATTTCAAGTCGCACTTCTAAACATAACAAGTTAGTTTGCAATTGACCATGACGTATCAGACCCGAAGCATCCTTACC
GTTGAGTTGACCACGACAACTTGTGGACGAACAATCAGTCTCAGGTACCCATCTGAGTTTCTTAATTCCAGACTATACGCGCTTGCTGTGCTGCTTAGCC
CCGCTCTCGCAGGCGGCACAACAATCGGTTTTGTATCGCCCCTCACATTGAGGGATACTTCTGGAGACCATTCCACCAAGCTCATCTCGCTGGTTGGGTC
ATCAATTGTTGCGATTGAAATCACCAACCGGTTGCTAGCCACGGAAAACCCAACGGATCGCTCAACACACGAGTCAAACTTTTGCACAGCTCCTTGGTTT
CCTAGTGGACTGCCGATGCTGACGTTGAGAATATTCGGCGTCATGTTTGCAACGCTAAGAATGCGCTCTGTTTTAGTCGGATCATGGGGCGACGATTATC
GCAGAAGCTTGCAATAACTCGGCAACCTTCGAAGTCGAAAATCTGGTCCTTGAAGTCCTTGGCAGGAGTACTGCACTCCAGCAAAAAACGGAGTGGTTTC
CGGGAAGCCTGGGTACTAGTTTGGTGCTGCTCGTACTGCAGCTGGACATCGACTGGCTCATAAGGGTTAACTGCAGATACACACTTTTCACTGGAGGGTG
CAATTTTTACGTTGACGGTTGTAGCCTAAGCACAAACAGAGAAGTTAGTACTCGCCCATCGTTGAACAAACAGGAAAACGCACGTCAAGCCTACCTTTTG
AGAGAAACTGAGTTCCACGGAAATATCCATGGTATTCTCCACTGTCACAGCGGGCCAGAATGACACTTCCATCCACGTGTATCGTCGTGATACGTGCGGT
TGCAACGGATCAAAGTCCGTAGGTAACACAGTCTTACACTGTACTCGACAGATTTGAGCCCAGGCATATTGAGTGGCCTCACCAGGGCTTCCTGACGAAG
CACCGCGAAGCTACACTGTGTTCTCTTGGGACTTTCAGCTTGGCCGTCGCTAATCTTCACAAGATCAAACTCATTAGGGAGACTGCCCTGTGCCGTCACA
CTGCACCAAGAGCCACCGTCGATGCCAAAATCGACGCTCGAGACCGACTCGACCATCACGCGTGAAATGTTGTCATCGGCACGTGTCGATGTACTAGTAG
AAAGAGTACATGCCGATCCATCCAATGAAATGCAGTTGGGATGATGGTGGGCGCTTCTCTGAATAATTCGATTGTCTTGGTAAAGCTGATCGGACCCCGC
GCAGCCATGTTCACGGGCCTCCTCATTCAATTTGAATCGAACAGGAAAGTCGCAGTAATTACGGACTGTCAGGGAAGATCGAAGAGTGACTATCGTCTGC
AACCCACTCAGCTCCACACAAACCCACAAAAAGCCGTGGCAGTCAAAGTAGCGACCCGTAACAGCGTTTTTCTTAATGCTGCACGGGTCACACCAGCGGG
AATCCTCGTTTACTAGCAGCTCATTGTCACCCTGCATCTTTTCCCGGCTAGATTTCCTAATGAGATGTTGGTGTGGATCCTCCATAGCAAAGCGAAGCTG
GTAGAAAGGGCTGTTTGCCAGGGAGAGCCAGCTGTAGGCCGCACTCGTATCAGCAGGCAGCAGCAAACACTCCAAAGTTCCTTCTTGCTGATACCATATA
CCCATGCCCGCGTCGTTGACGATCCTTATCCGCATACTTGATAGGGCTCCGTCGATAACGGGTTGAGAGGGCTTCAAATTTGGCTGCAAAAGCCTCGGAA
TTGAAGACATCACCAGCATCGACGTCTGGTTTAGGTACACGAAGACAGGTCCAATGAGTGTAGAGACCTCAAGGCCCTTTGAGGAAAGCTCAATCATCGC
GTCAACGGTAGTCCGTGGGATAACAGACACAGTCAGTAGTTGGGCCATGTTGT