Description :
From Genome Similarity Track
Location :
Scaffold_131:23322- 25291
Transcript NameFunction/comments
g3019.t1hypothetical protein

Sequence
1969 bases(100 bases per row)
TCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGTC
ACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACC
TTCTGTGTGAAGAAGGCTACTGGCGGGGGGCGCATCGTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGG
ACATGGTACTGGACTCCATGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCT
CACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCAT
GTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGC
GGCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTG
CTACGTAAGCAAAAACGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTG
GGCCTCGCTAACTACTTGCACAAGTATACGAAGGGATATGCTGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCC
CCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTTCACGTCGTCTGCGA
CGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCCGCGAACGAGTCGTGAGCTATCAATCACGACAGATGAAGCCGGCCGAA
CGCAACTATCCCGTCCACGACAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGAGAACAGACGTTCGCGGTGTACA
CGGATCACGCATCGCTGCGCACAGCGATGAAGTCTCCACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCA
CTACAAGCCCGGCAAGAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACGAGCGACGCGGGGTCGTCAAGTGATTGACGAAGAC
GAGGATGACGAAGATCACTGCGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACCCCAGAAATGTCGCTACGCGAAGAAATCGCCGTTGCGT
ACAACGACGACGCGGTATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAA
CCGATATCAACTCGACGGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATC
ATCCACGAGTTCCACGACAGCCCTGTCGGTGGTCACTTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAAT
GGGTGCGCAAGTGGGTCCGTACTTGTGAGATTTGCCAGCACGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTGAGGC
GTGGCGCTCAGTGTCGATGGACTTCATCTTCGGGCTTCCACCCGATGCCGACGGACGGACTGGCGTCTT