Description :
From Genome Similarity Track
Location :
Scaffold_3:233210- 234212
Transcript NameFunction/comments
Physo_496381ankyrin-like protein

Sequence
1002 bases(100 bases per row)
TCCATTGCTGACGTCGTGCAGCCAACGCTACGGTGCCGATGGAGCCACTGCACCACTTCGAGGTGGCCTTCGCGAGCTGCGCCGTCCATCGCAGACGTTG
TGCAGTTGGCGTTTAAGTGTTCGTGTAAGTACTGAACGATATCAAGTCGTCCGTTGGAAGCAGCGTCATCCAACCAGACTCCAAAGCAGCGGTCTGTTCG
ACGCTCGTGGAGCCACTTCAGGACATCCAGATGACCACTGCGAGCCGCAGCATCCAAGGCAGCGGTGCCGCTTACCTGTTCCCCGTGTTCATGCAGCCAC
TTCACAAGCATTAGATGCCCATGCTCCGCTGCGGTGATCATCGTCGCAGCGTCACACCCGTCACACCCGTTCTCGTGGAACCACTGCACTGCATCCAGAT
GCCCATTCTGAGCCGCCTTCCGCATCGCGTCCGCGGTCAAATTCGCTCCGAGCTCATCGTGCAGCCACTTCACAATGTCCAAGTGACCATTCCAAGCCGC
AGCCTGAAGCGTGAAATACCCCGGACTGCCGATGGAGTGAGCGTGCAGGAACTTGAGAAACGACAGCGCACCGTCTTTCGCTGGTTGGTCCCAGTTGATC
CACGGCATCACCAGCTCACCGTGCTCGAGGATCCACTGACTCGTTTCCCACTGCCGGTTGCTCATGGCGTTGGCCAGCGCACTGCGCACGCTAACCTTGT
GCTCGTCGTGCAGCCACTGCACAATGCTCAAGTATCCAGCTCCAGCCGCCGCATCCATCACCTTCGTCATGCACTCCGCTCTTGGAACTGCGTGTGTCCG
TAGCCACTCGACCACATTCGCGTGGTTATTCGCCAACGCGCCGCACATCTCCGTGTTGCCCCAATATCCTCTGTCGTGGTGGGCCTTATAAAGCCATTCC
AGTACTGGCAGGTGTCCATTCGCAGCGGCTGCAGCTACTGCCTTGGTCAGGAACTCATCTGGCAAATAACTTTGCACAAGCCACTGAAGCGCCTCCAGGT
CA