Description :
From Genome Similarity Track
Location :
Scaffold_620:23317- 24941
Transcript NameFunction/comments
Phyta_totarag9723hypothetical protein

Sequence
1624 bases(100 bases per row)
accttcttccttggtgtgaggtACACCAATgactacatttaggcggacaactggtccgcatgcatttGCAaatctcattggtagaaagcagcatttTTTC
TACTCAATTAGAATAGTAGGCTTCTGTCGACACCCATCGGCAGACCCTCTATATAGTATGACATTCAGGAGGTAATTCTTTACAAAAAGaagcaaataaa
acacagttctcaatttcacctaaatTATTAATTATAGTCTTTAATATATccttaattatacttgcaggaccCAAGTTTAATAAAGCCCTCACATCTAAGC
TaaagtattgggctaagtaggtCTAttacacctggtagcactttgTAGTCTGTCCAACGACGACTAACTGCCCGTTCGTATGACGTCTTACGAACGTGGG
CaagagaaaaaaaaacttccGTCGGACGGAAGTCCAACTGCATCTGCCCCCACCTGTCGGACCCAGAGTGGGAGGCGCTCCAACGACTGTCAATAGTCAT
TGGCGAGGCGGCTGTAGCGGCAATGCTGTGAACGCTATCACCGACAGAGCAACACGGTGTTGCTCAGGCCTTCATCGTAAaggagcagcgagatgcaGCT
ATCTCTaggacggcgtcgtcctcgatgcCACCGTGATCGATATGTTCAGTGACCAAATACGTGGGAAAGAGGGTAAACCTCTTCTCCGTTGGCTTGTCGA
AGTCAACACAGCTATTACGGCTCGACCCATCGTCGTCCCGTTGTCGAAGGTTGTCTTCGCCATGTCAAGCCTTGGCGGATGAGCAAGGAGTTGGGCGTAC
GAACGCCGACGCGCGGACCCTACGTGCTTCGGCACCTACGAAGATTTCACGCAGGAGCTCAGACGAGCGTTTGAGCCCCCGCAAAACGAATTCCGATCGA
GGGCAGAGTTCCACGATCTGCAACAGGGCAAGCATGACGTTCACGCTTACACCCAAAGGGCACGGTACTTGGTCTCGAACATCTTGACCAACCCGATAGA
CGAGGCGACCAAGGTCGTTACGTTCATGAAGGGCTTGAAGGATGGGCCTGTGAAGCCCTACCACTTCCGAGAGTACCCGAGTACTCTCGAATCTGCGATC
ACGTTCGCAATACAAGAAGAGTTTAGCCTGCAGCAGGCTAAACTGCATGTGAACGTACCACGGATGTCACGTCCGGTGATAAGGACGGGAGGCCCAGATC
CAATGGACCTCTCGAACGCGACGGCTGGGAATCACCCACCCCGTCGTGGGGCTGACGTACGATGCTTCTGCTGCGGACGCATCGGTCATTTTGTCCGCAA
GTGCACAGCACCTGTGCACGGGTAGAGAGGCCAACATGGCGATGCTGGACATCGCCGCGATCAATAAAAAACGCTCGGAACCAGTAGGCGCGGGGCGCCC
TACTGGTGAAGTAGTCAAGCGCGCCGACATTGGACACGCGTCAATGAGGACTGCAGCCCCCAGTGAGAGGCATTATCACTGCATCAAGCGAGATGACAAG
CCAAACCTTGTCATCATGGACGTGGCTTCGAAGAGGACAGACTCTCGTCGTGTCTTGGTAGACTCAGGTGCGTCGAACAACTttgttcgacagcaaagtc
TGNCCAAAGatggactggaagaag