Description :
From Genome Similarity Track
Location :
scaffold_349:23312- 26392
Transcript NameFunction/comments
Pl_105792conserved hypothetical protein
Pl_105793hypothetical protein PHYSODRAFT_476751
Pl_105794hypothetical protein PHYSODRAFT_386046

Sequence
3080 bases(100 bases per row)
ACAAACCTCTGATGCTGTGAATACGTTGGTGAGCAGTGTAGCGACCGACGCTGGAGGAGTGCTGAAGGAGCCCAAAACTGGTAAAAACGAGTACGAAAAC
CTTGCCCAGTTGTCCAGTATTCCGTTTGTGGAGTGGTTTACGTGGTGCCAGTCCTGCAAACACGGTGGTCACGCACACCATTTAGCAGATTGGTTTAAGA
CGCACACGGTGTGTCCTGTTACTGACTGCAACTGCCAGTGCCAACATCTAGACTTGCCAATCGTGGGCGACGACAACCAAACTGCAGTTATCGAGCAACA
ACGAGCAAGCGCTGCAGCACTAGCCACCCAACGCGCCGTGTCTAAGGGGAAAAAGAAGCAACAGCAGCAGCAGTATCAGCAACAAAAATCACAGGAGTCG
AAGGCGCCGATGCGTAGTGCAAAGAAATCATTCCTGGACAAGCAGCAACAGCAGGCGTCTATGGGGTCGCAGAGCTCTCAGCACAGCTTCTCGGTCTCTT
CTACCATAGGGACAGGCTCGACGTATCGCTCTTTCTCATCTGCTCAACTGAGACCAAGTGGTACTAGTGGTGGTTACCCACCACCCTTCTCATTATCTGG
AAGCAACTCCATGGCAAACCTCTCGAGTGGTGTAAACTCGGTTGGTACTGGCAGTAACGTTGGCAGCGGACCGGTTAGCGACGGAATTTCTCTGGGCAAC
AAACTGGACCAGTTGGAGAAGGACAAGAACAGTTATCAGTACATGTGAGAGCATCGAGCGGTGTGAACAAGGTACGAATGAGTATTCGATCGATAAATGA
ATTGGTTTTGGTATGTTCAAACAGGATGCAACTGGCAAAGACCCCTGAATCGTTATAGCTTGACAGGGAACGAGTTCGTGACTCCCAAGCGAGAAACTCG
GCGACTATAATCATCCATGATCTCCTGCTCGGTGGTACCCAGTCGTTTGATAGCTCGCTCGCGGTGCAATTGCTCGTCGTTGAAGCCGAACATGAACTCA
ACTTTGGATGACGGTTCGAGCTGTGAAACGCCGGTGTACCGCCGCAGTTCTTCGCTTCGGACGATATCGACGTCGCAGATCCCGAGCTTCTTCATGCCCT
TCTCTTTTTTCAAGATGTCAGTGTTGACTCCAAGACGATCTAGTGCGTGGTGACTGATCTCATCCGCTGCTGAGCTCGTGACGCGTCGCTTGGCTGGTTG
AGTTGTTTCCGCAATACCCAGCTTTGGTGGCGTCTCGGTCGGGAGGATCGGCTCCATGTTGGCTGTCAGTTCCCACGACACGTTTGGAGCACTGTTCTGT
CGGATCGGCTGATCTGGTGGTGGCATATTTGCGACTGATGCTGGGATTTCGCCTTTCGTTGGTGGCGACTTGTCCTCGTCTGCTTCTTCGAGCTGCAGTC
GAGGCGATGCGGTCGGGGATTGAGCACGGAGCGAGCTGCGACCACTCAGAACAATGCAGACTTCTTCTTCGTCGTTTACGGACTGTGGCAAGTTAAACAA
CGGGGTGATTTCCCCGTCAACCGCGGATAACGACGCTATAGTGCTTCGAGTTTCTCCGCGTCGAGCGAAGACAGGAGTGTGTGAGCTGAGCTGGCAGGTG
GTTATGGTTAGATGGCGAGGTAGATGGCAAATTCGGAGATGGAAACGCAAAGATCCGTTCGTCGGAGCGTCGCGAACCGTTATCAGCGGCTCGAAACGCA
TAACGTGATGCGTGGATGTTCGTCCTCAAGCTGCGAAATTGAGGCACGATATTGTTGACGGGCATTCCCAATTAGCAACCTGCGGAAAAACCAGCATCTT
ATCAGCGAGGACGAACGGATTTGACGTCAAGCAAGCATACCTCATGTAAAATCTGAAACTGAACCACCCGGAGGACCACGTCGTCGTTTGGTGTTGTCAC
GGAGAGCTGTAGATATTCACCGGCCATCCACTCCATTGCTGGAAGATAGAAAACCAAATCACGGCCATTGCGCAGTGCACCGTGCATAGCAAAACAGGTT
CCTTCAACCACAGTTTGGTTCGTGTGAGGGTCCCAGCAGCTGGAGCGCTGGAGCTGCCACCAAAAGCGTGAGTTCAGCTCGTTTATCTTTTCATCCGCCG
TGGGAGCAAGCCTTTCAGGAAGCTGTACACGGGCTAGAAGGCGGAAAACACCAGTGGTGTGAATGTAGACCCTTTGGACTACACCCTCCCACAAGAATGA
TGACGGATTTACACCGTCCTGTGCTGCTAACATCATTCGTCGCTGTGGCTTCATTCGCCACGGAATTGGAGATCCTGTAAAGCTTTGCGGTATGCTGAGC
AAGAGATGCTGACGATCTTGTGGCTTGATAACACAGCAAAGAGTGTCAGTGGTTAACAGCTTTTAGACCGTCGACACAGGACTTACATGATGTGAGATGA
ATACGATGTCTTTGACGAACACTTTGTACGGCTGCTTGAGATCCTCCCCGTGGTTGATACCGAGTTGGAGAGATAGTGAATCACCCTTCTCGCAGTACAC
AACTGCTGAGTATAGCGCATACGAAGAAGAACCTGCGTGATAAATTCATGTCAAGGCTGACAACAACCCCGCACTTGTTGATATTCGTTCATACCTTCTT
CGTCATGGAAATGCGCCGTTGCTGCTTCGTCCTCCAGAACTCCACGCGCATCGCACTTGCGATGTACCACCAACTTCCATGCAAGAGGTGAGCTATGCAT
CAGTGAACTACTCGCTGAGGCCTTATGCGTCGCCTTCACCGCCATTCTCCATTTCAAACTGTGCCGTCCATCTTTTGTGATCTCCCGCTTCCACACTCGT
GTGAAAGCTGCTGCGTCGTCCAGCTCCACGATCGTACTAAGAATGTGTCGCTTTTTCGAAGGTGCAGCTTCGTCGTTGGTTCTTGGGTCGGTCAATGCTG
TGACTACATCAAGGACGTAGTCATCAGAAATGCGATTCTTGACCAAAGCGCCATGAAGCATGCGTTCTTGAGCTACGTTGGCACCCACACTATAAACACA
ATTCACAAGGTGAGATGTGTTACACTACCCGCTTTCGTGTATGCTTTACCTATTCAGCTGCCCCAAGCTCAGTAATGCTC