Description :
From Genome Similarity Track
Location :
contig_188:23312- 25634
Sequence
2322 bases(100 bases per row)
GACAGTCTGGCCATTAAGGCTGGCTTGGACGCACTCGACAACTCCTCACTCGGACGCCGTGACAACTTCGAGCTCAACCAGGATGAGACATCGGCCGTAA
TACTTCGCTTTTTCGCCTCTTTGTGAAGACAAACAGGGACACACCATCCCGCATTGTTACCGGAGATTACCGATGGCTCGTCTTCATCTACAAGCACGTT
TCCTCGACCGTCAGTTGGAACGCATTTCAAGTCGCACTTCTAAACATAACAAGTTAGTTTGCAATTGACCATGACGTATCAGACCCGAAGCATCCTTACC
GTTGAGTTGACCACGACAACTTGTGGACGAACAATCAGTCTCAGGTACCCATCTGAGTTTCTTAATTCCAGACTATACGCGCTTGCTGTGCTGCTTAGCC
CCGCTCTCGCAGGCGGCACAACAATCGGTTTTGTATCGCCCCTCACATTGAGGGATACTTCTGGAGACCATTCCACCAAGCTCATCTCGCTGGTTGGGTC
ATCAATTGTTGCGATTGAAATCACCAACCGGTTGCTAGCCACGGAAAACCCAACGGATCGCTCAACACACGAGTCAAACTTTTGCACAGCTCCTTGGTTT
CCTAGTGGACTGCCGATGCTGACGTTGAGAATATTTGGCGTCATGTTTGCAACGCTAAGAATGCGCTCTGTTCTTAGTCGGATCATGGGGCGACGATTAT
CGCAGAAGCTTGCAATAACTCGGCAACCTTCGAAGTCGAAAATCTGGTCCTTGAAGTCCTTGGCAGGAGTACTGCACTCCAGCAAAAAACGGAGTGGTTT
CCGGGAAGCCTGGGTACTAGTTTGGTGCTGCTCGTACTGCAGCTGGACATCGACTGGCTCATAAGGGTTAACTGCAGATACACACTTTTCACTGGAGGGT
GCAATTTTTACGTTGACGGTTGTAGCCTAAGCACAAACAGAGAAGTTAGTACTCGCCCATCGTTGAAACAAACAGGAAAACGCACGTCAAGCCTACCTTT
TGAGAGAAACTGAGTTCCACGGGAATATCCATGGTATTCTCCACTGTCACAGCGGGCCAGAATGACACTTCCATCCACGTGTATCGTCGTGATACGTGCG
GTTGCAACGGATCAAAGTCCGTAGGTAACACAGTCTTACACTGTACTCGACAGATTTGACCCCAGGCATATTGAGTGGCCTCACCAGGGCTTCCTGACGA
AGCACCGCGAAGCTACACTGTGTTCTCTTGGGACTTTCAGCTTGGCCGTCGCTAATCTTCACAAGATCAAACTCATTAGGGAGACTGCCCTGTGTCGTCA
CACTGCACCAAGAGCCACCGTCGATGCCAAAATCGACGCTCGAGACCGACTCGACCATCACGCGTGAAATGTTGTCATCGGCACGTGTCGATGTACTAGT
AGAAAGAGTACATGCCGATCCATCCAATGAAATGCAGTTGGGATGATGGTGGGCGCTTCTCTGAATAATTCGATTGTCTTGGTAAAGCTGATCGGACCCC
GCGCAGCCATGTTCACGGGCCTCCTCACTCAATTTGAATCGAACAGGAAAGTCGCAGTAATTACGGACTGTCAGGGAAGATCGAAGAGTGACTATCGTCT
GCAACCCACTCAGCTCCACACAAACCCACAAAAAGCCGTGGCAGTCAAAGTAGCGACCCGTAACAGCGTTTTTCTTAATGCTGCACGGGTCACACCAGCG
GGAATCCTCGTTTACTAGCAGCTCATTGTCACCCTGCATCTTTTCCCGGCTAGATTGCCTAATGAGATGTTGGTGTGGATCCTCCATAGCAAAGCGAAGC
TGGTAGAAAGGGCTGTTTGCCAGGGAGAGCCAGCTGTAGGCCGCACTCGTATCAGCAGGCAGCAGCAAACACTCCAAAGTTCCTTCTTGCTGATACCATA
TATCCATGCCCGCGTAGTTGACGATCCTTATCCGCATACTTGATAGGGCTCCGTCGATAACGGGTTGAGAGGGCTTCAAATTTGGCTGCAAAAGCCTCGG
AATTGAAGACATCACCAGCATCGACGTCTGGTTTAGGTACACGGAGACAGGTCCAATGAGTGTAGAGACCTCAAGGCCCTTTGAGGACAGCTCAATCATC
GCGTCAACGGTAGTCCGTGGGATAACAGACACAGTCAGTAGTTGGGCCATGTTGTCCAGGTAAACTTGCACTGCTGACGACACTTGCACATTCAGTGTTC
TTGAGTGGCTGCCACCGGAACCCACGCAAGAAAGGATTGTGTCATTGAGCTCAGCAGTGATGATGTCATGGGAGTCGTTCGCTGAACCCACATGACTGAC
AGACAGCGAGGCTTGAGGGAGT