Description :
From Genome Similarity Track
Location :
Scaffold_5:2331021- 2350677
Transcript NameFunction/comments
Physo_510315aldo/keto reductase
Physo_249107Hypothetical protein
Physo_509646exodeoxyribonuclease X
Physo_507829Hypothetical protein
Physo_335019Hypothetical protein
Physo_287906pol protein
Physo_508642Hypothetical protein
Physo_508994vacuolar protein sorting-associated protein, putative

Sequence
19656 bases(100 bases per row)
ACTGGACGAGAAATGCGTGAGTCAGCAGGTGCTTTTCCACAGCTAGATGCGCTAAGTGTGTGGCGTATTTGGTGGCTTGGCCACCCTGCTGCCGGATACC
CGCCTTTTCGGGCGCTGCAGCCATCTGACTTCACGAAGACCAACCGCAAGATGTTTTCGGAATGGACGGTGGTGGTCCGACATATCGTCGCTGGTGTGGA
GGCAAGTACAGGGGCGAGAATGCAGCGACCAACTTCACAACGTGAAGCCGACGATCTCTACGAACTCGGCATAGCTCATGTGCCGATGAAGCCGCCTACC
CATGCGACGAAGCAACGGCCCGAGCGAGCAGTAACCACACTGCGACGAATCCGGCAGGCAATCCACGAGTCGAATCCGGAGGCGAGGCGTGTGCCATGAA
GCGCACTAGAAGCACCAAATAGAGGTTAACAGCATTAACAAGGCGTTAGTCGTGATGGCGCAGCACATTAGCTCGTTCGATAGATGCTTGTTCGTCTTAC
CTCGCCGCCGTTCCCGTCGAAGATGCACGACAATGGGATCTGGCGCCCCGCAGAGTGAGTACTGCCCTGTAGTGATGAGAATATTAGCCAATCAGGCGAC
GTTCGTTATGCGTGTCACGACCCGGTTACGGGATCTGGACACAAGTCATTAATTATTTTTTTGTATGGACTATCTATATCAGCTGACATATACTTATCAC
CATGTCTGACACAACTCAATTAACATACGCTTATCTACTCCAGTCGGCTCTCAAGACCGAATCGGCTATCGATGTCAGCAAGGGCAAGACCATCTCGGTT
GTCTATGATGGCAACCAGGGTTCTTACAACTCTGGCTTGATTAAGATTGATGCTACTTCTCAGCTTACCGGATCGCGTGGATTTGCTAGCCTCAAGAAGG
CGTATCTCACCCTACCGTATGTGATTACCGCCAAATCGACTGGCACGGCGGATCTAAATGCGAAGACTATTCCTCGATTTGCATGTGCGCTCAAATGCAA
CGTTGCCAACGTTATTGACTCGCTGACGGTTGAACTTAACGGCAAAAAAGTAATCACTGAAATTGAGTACAAGGGCTTCTGGAACAATCTCCGTGCTATG
ACGGAACTTTCGCAGGACGAGGTAGCCAAGCATGGTGCTGACATGCATCTATATCCGGATACTTGGTCGAGCATCAACGTCACCAAAGCTGTTTCTGGTA
CTGGAGATGGCTATAGCAACAATCAAATTGGTATTGAAGCCAAGCTTGATAACACTCTCTCGCAAACACAGGAGCCGTATGCTCACAATCCTGGATTTTT
CAAGCGCGCGCTGAATACTCCTCCTCAAATCGACTCGACGGAGGCAACCGGATCTTTCTCTTGGGCTTCCATGGGAACTACTGCTAGCAAGCAAATTCTA
CAGGAGAATGGTCGTGGTTGTTTTAGGGAGTCTGATGCTACGTCGTATGGAGTTGATAAGGTCGTTGGTAAGTGGTTTCACATGCTTAAGATCAGCACTC
GTCGATTTGCATCCGATTTTTAAGGAGCCAGATCTATGCTGTAACCCGCAGTTGAAGATCCGTCTTCGTATCGATGCTGGTACGGTTGCTGTATCTGGCA
ACGTGAATCAAATGAAGCTTGATTCTGTCACCATGACCTCTGGTCAGACGGTTCCTATCATGATTACAAGTGCTGCTGCGGCTAATCCCATGAATGATGT
GCTGACTACTGCTAGTTCTCAGCTGTCGTTCTCGTTCGGCCCGCTTGGAAATGCATTTACTCCGACTGCTTCGGTCGGTGAGCATCTCCCATACACGAAC
TCGAGGCTCCACATTCCGTTCTACGCGCTCAAGAACCCCGCGCCAATCATCCAGAAGCCGATCAAGACTGTTCGCTACCTTGATTGCTTTGCACAAATGT
TCCGCAAAGCCGCTGGAGTGTCTCCTGATACCCCCACTGGCCAGCCGAATGCTCCGTTCGATCTCAACATCTCTGGATACAAGAAGAATGTGAAGTAAGC
TTTGATCCCTTTCAGTGAAACATCGGCTGGACACTTCGTATCGCTTAGTGGTACGCCTCAGTATCAATCGCCGTTTGATTCTGCACCGTGGACCTGTATG
CCTGGCGCTTCCATTCGTAATTTCCAGGTAACCATTGGTAATACCAACGTCTTCGACAAAAGCCAGGAGTACGATTTTGAGTCGTTCAAGCATGAGTTCA
GCAAGCTAGGCGCCATCAACGGAGATTTGAATCAGAAGGTCAGCAATGGTCTGATTGACTCGGTTCAGTGATCGATGGCTCAGCGCATTCTCGTAGCCGA
TACGTCTCGTCTCACCCAGAAGGATGTACCTCAGGCGATTCAGGTCAGCGGCATCAACGGCTCGGCTACTGGCATGGATCTTCTCGTACTGGTCGTATAC
GAGCGTGAGCTTGAGATCGACCGTCTCACGGGAGAGGTCCACAGAACCGATTAAGCATCTCTCGTTGAATTGAATTTATTTTAATAAGCGAGCTTAGAGC
CTTTGGCTCTAAGCTTGCGCCTCTTGCCGTCAGGATAATAATTACGATGTGGCCTAGAATTCCATTGCACTAGTCGATTGACACCTGAAACTGAATAATT
TGGCAAATGGGTTCTTGTAAGTCCACTCTCATAATTGATTAATTTATATATTTTCAAAAGAATCATGTGGATATCTATATAGATAGATAACAATGAGTAC
ATTAAATTTTGGCAAGCACAAATCGAAGACTATTGAGGAGGTATACGAGTCTGACCCTGGATACTGCCGCTGGCTATCGAATCAAAAAGGTCTCGTTGCA
CATAGTAGTGACTTTGCCAAATTCCTAGCCCAAAAATTTGGCAATGACGATGGATCGTATGTGATGTCCTTCGGTAAGTATAAGTCGAAGACTATTAAAC
AGATCCAAGCCATTGATGCTAAATACCTTGAATGGTTGAGCAAGAATGAATTCGTTCAGACCAAGATGCCTAAGCTGAAAGCAGAAGTTGATGAACTTCT
AAAGTAAGCTTGTGTCTAATTTTTGTCTTAAAAGTATTGACATCATTTATGATTAAAATAGAGATGTCGCTCACATTTGAGTAAACTGCTGATGCTTACG
CGATCGACAGTGTTGTGATCGGTTTGAACTTCGATATGAAACCCGACATCCACAATCAATACGCTCTGCGCTATGATCTTGAATCTCTTCCTTTGTTCTA
AGTGCCGCTTGCTTATTAATAACACCTTGAGTTGAGTCAATTGCAAGCTGTTCAAAAGACAACAGACTTTTTCGATTTGGTATTTCATGCTCACTAATCA
GTGAAATTGTAAAGTTCTCAACACCATGCTCTCGGAAATGGTAGTAAATAGCTGTTTTGCTAATATCTACACCATTAATCCAACGCCTAAATTTACATTT
GTGCTCCGAAAATCGTTGCCATAATGGTTTTACAGTACTCCCAATATATACTATTGAATCATCAGCGTTGGAAATCTTGTAGATGCGACCGATCATGGTT
GTTGGTTGGTTGCTGCAGTGTATGCTCTTAGGGTTTATATACTTAAGATTTATCTCTTAAGATAGAATGTTTTTTATTTGTGAGCTATTGAGAAGATGTT
TGGACACCGTGCGAGAAGGAGGAGGGTTATTTTAATCTAATGAGATAAGAAGTGTTCTGCAGAGTTTTAAAGAGAAGAACAGAAATTGGGTAAGCTGGGG
TTGTGGTTAGAGGAATGGGTCTCTGAGTGTTCTTATATCGGGAGAAAATGAGAGTGGACACAATGACCCGTTCCGGGTATATACTGCCGCAGCTTGAGAT
TACTTTGAACTCGTTGCTGTGGCGCCGGGAGTCCGCCTCTGTGCTGACCCAGTTTCCGGCCGGGCGCTTCGCGGAGAGGCTCTTCTTCACGACGTCCCTG
CTCCACCGTATCCTCGACCGGGCGCGGCGTGGCGACATCCCCATTCAAGGGCCGGTTGCCACGGGGCCAGCCTGGGATGACCTCGCAGAGAGACTCATGT
TCGCGCTCAACACGTCGTTTGATGCAACCCGGCTGGACACCCCATTCTACCTGGTCCATGGTTGGGATGCCAAGAGTACGGTCTCAGCTATGCTGGGGCC
TAAACCTTCCAGTGTCCCTGAACGGACCGCGTATGAGTGGCGAAGGAAACTCCAGCGAGACTACAGCTACGCTCGGGCATGTGCAGCAGACCTCCAGAGG
AAGGCCAAACGGGCTCGCTCGGAAGAGCAGACCCGGAAGTGGAACGAGCTGTCAGATCGGCTCAAGGCAGGTTTCAACGTTGGGGATGCAGTCTGGCTGT
ACATCCCAAAAGTGCAGCCAGGTCTGAGTCGCAAGTTGGTCCAGTTGTGGCATGGGTTGACGAGTTCCGGGTGAGGCTCAAGGTCGAGGACACGGGTTAC
CGCGTAAACCCTTGGGTTCCCATCAGTCGGCTGAAACCCCGGGCGTTGTATCCCAGACGGCCTATAATCCAACCGGAGATCGAAGACGACGATGACTTCG
ACACAGCGCTCCTTCCCTAGGACAGTTGGGAAGCGGGCAACGAGAATGACGAGTACGAAGTGGAGAAGATCATGGATCTCAGTTGGAACAAGTGTACACG
GACGTCCGAACGGGCACGAGAGTATCTCATCAAATGGAAGGGATATGATGAGCCTGAATGGATACCGATGGCACAGCTGAATTGCGGAGCGCTCTTGTAT
GAGTTCAATCAAGGGGCGAAAGCCCGAGCGCGTTTCCAAGCCATGCAGGCTGGGGACGACCACCCTAGCATACAATAGTTGGGAGTGGTCAAGTCCGAAT
GGGGCGATCCCAATTGGGAGTATTGATCCCAGTTGGAAATTCCCAGACGGAGACCCGAAATTCCTGGATGTGAATGTGTGAACTACGGAGAATTGATTGT
GAATTTGTATGGAGCGGATCTACGATGGAGTTGTGACTATGGAGAGTAACCCGAGCGAGATTGGAGTTTTCGATGACGAGTGTATGAGGTTGACTATGCT
GGCCTGAAGGAGATGCCAAAGCGGCAAGAGAGGAACAAAACCGCGCCCAAAAGTTGAACCGACCTGGATAACCTGACCGACGAAGGATACGATGAAGACA
GCGAAGACATTAACGGTGATTGTGGAATTAGAGTGTTACGCTACGGATATGCAACTACATCCAGGACTGTTGTGGATGCTGGATGGGATGACCTCACTGG
AACTTGGTCGCGACCCAGTTGTCGACGCGCTCGTGCTCATGGAGCAGCTTCTTGTCAACGATATTGGCTGGGACGTGCACCAGACGCTCGTCATCCGTGC
AGGTACTCCACTGAGTCCGGCCGGGGTCTTCGAGTTCGGCCCTCGCGATCTGGTCAGCCAGGGTGTAACGCGTGCCATCGACCTTCTTGGTTGACTCGTC
GACCAGGTACATGTAGCAGATCTTGCACGGGTACAACCAGAATCCAGGCTCCCAGACCATCGTTTTCGGCATGCCGGCCTTGATCAGACGCTTGATTCCG
GCCTCGAAGGTCCGCGCAACCCCGTCGTGGAACGCCTGGCGCTTGCGGTGGAGGTCTTGAGCCCGTTCGTAGATCGTGAGGTCGTCACACTTCTCGTCGT
CTTCAGGCTTGGTCTTCATCATGAACCAGTACAGGATGTGCCAGAAGGCTGGAAGGTGATCCTTCATGTACTCCACATGTTGGTCCAGAATGTGGATCAC
AGGTAGGGATAGGTGGCCCCGGCGGTGGAAGTACAGGACCTTGACCCGCTTGTTGAACATCTCCAGCCAGGGTTCCTTCGCGACCAGGGCCGCATACTCA
TCTTCGACTGAGGGCCAACGCCTGGCCAAGAACTTGGTCTCGGGTTGATGGGGCGCGTAGTTCGGGAAGCCCGGGGTCTGCCCTTCGATACCACCCTTCT
TGGGAGCAAACCGAGAGCCAATGCCGCGACTACGCCACGAGACAATATCTCCGGACGGGACCTCGATGATCGCCAACTCTTCGGCAGTCAGGTCCTCATA
GGACTTCAGAGCCAGGGGCGACTTGCCGCCCTCCCGTTTGGTTTTCGACGTACGACTGCGTTTCTTCGGATTTTTCTTGGACGATGTCCGATCGGGCTTG
TCTTTCAACGCAAACTTGGACCGAGGGGACTGGGGTGTTTTCTGGGACGACAACCGGGGAGGCCGACGCTGTGACGAAGAAGATGATTGGAGCTCGTCCT
CAGATGAGCTGTCCGAGGATGACTCGACGCGGTTCCGCTTAGGCTTGCGCTTGGCCGGCTGTTCCTCTTCCTCGCTGCTGCTCGAAGAGCTGCTTTCCTC
GACGGACTCCGCCTTGGAGGGCCCATCCGCGCTCTTCCCAGATGAAGATGCCTTGGCCTTGCCCTCGTAGTCGGAGTCACTGGAGTCATCGCTTTCACTG
GAGTCGTCGACTTCGACGATTTCCATCTCGGCAGCAGCGTCCTCGGCCAGGTTGCGTAGTGGCGGAAACTCCTCCGGATACATACCCGACCGGGACGACC
CTGGAGCATGACCTCGGCCATCTTGTAGAAGGTCTCGGGGGCATGACGCGTCCAGAGAGTGTCGTCCAGGGTGCCATGATACATCATCTTGACTAGCATC
TCCAGCAACCAAGGCTTGGGGAAATACTGGTGGGCCGGACGGTCCTGACGGGGGATGTCCAAGGTCTCTTCGTACCCATTTTCCATCCGCATGACAAACT
GGGCATCCAGCCGGGCATCCGACCAAGAGACGAACTCCGGCAGGGATGCAGCACAGTCGGAAATCAGACGCTTGAAGTCCGTCTGGGGCGGCAGAGGGAG
CACATCAGACCCCGGATGGACCGGGGGTCGCATTTGGACGTACACCGGCCCACCCTTGCTGGAAAGCTCGGCCATACCACGTGGACATGACCCCGAACGT
GATCCCCTGGACGTACGCCGCTTGGACTTGGACGGAGACCCATCCGCAGGGGAAGTCCGAGCGGGGAGGAGTGGGTGGATTGTCCTCCGACTTCTCTTCA
CGATCCCCATCCTGGCCTCCGTTGCCATCGCCTGCCTGGTAGTTGTCGTCATCGTCCTCGACGTCCGGGTCAACTGGGCCCGGATAGGGCGGGATCATCC
TGAACGGACGGTCGGCAGCCTCGACGGTGATGTTGGTGACCCAGTGTGCGGGAGGAATGGACCCCCGTTGGAAATGCCGAAGCAGGCGCACCAGCCTAGG
CCAACGACCGCGAGTAGCAGCCCCACCTCGGTTGAGGAACTGCATCAGCCGGTCGGCGTCGAATGCGGCCTCCTGGCCGGAGATACGAAGACGTTGGACG
GCCAAGATCGCGCGCTCGAGCTTGGCCTCAGCCTCGGTGACCTTGTTGCGTTGCGCGTTTTCTTCCACCAGATGGTTCTGCGCCGCGAGCGCGAAATCTC
TCTCCAGCTGGGCTTGGAGCTATTTCCGGAGTGCAGCCACTTCCCGCTGGTGATACATCTGCAAGAAGCGATGTGCGTCGAGGAGCTTGTCGTACCCCTG
CTGCAGGGTGGCGCCCCCGCCGGGAGATACCTCACCTGTCGTGAAGGTTCCCTCAGAGCTCCACGACGCGACAGGTCTCTCACTGTGCTCTCTTGCGGTC
GGCGACCTTCCAGCCGACTGCGCACCTGCCTCCGATGCCTCTTGGATCGTTAGCCCGTCATTGGAAGTAGTACTCCCGGGTGGCGGCACCATTGTGGAGT
AGCGGCCTCACAGAAATCGCGGAGTTCGTCCTCGCACAAACCCGACGCGTCCAATCTGCGGTCGCGACGGGCAATTTCCCGGATCTTGAGTAACGTATCT
TCGAATATAGAGCCCAAGTCTTCGCAAGCTTCAGAGTTGGGGGGTTGAGTGGACGCTTGTTCCTTGTATTAGGGCGTCGGTTGTTCCTTGGGCGTGCGGA
CTTATCGGGCCGGCGTTTCCTGGGGCTTGTTGCGTGGCATTATCGGGCCGGCGCGGTGTCTTGTGCACAGCGGTTATCAGGCCGTGCGGTCCTTCGTCTA
AGCTGCGCGTTATCGAGCGCCTCCTAACCGGCATACGTTTTGCGTGCCTTTGTTTCCGACACGGGGTTTGACGGGGGTGAGTGTCCGAGCCAGCGAGCGA
CGGGGGGCCGCGTATTCCTTGCGGCTCTGCTTGCCGACGCTTGGTGGTTCGTAAGAACCTGGCGATCTTCCGGAGGGGAGAGGTCTGAGTGGTTCAGAGA
AATTTCGGGACTGAGTCCTTACCCTATCCTATGTCCTTGCTACTGGCTACTCTGTACTACCGCTTGCTAAGCCTACCGCTCTGTACCTATCCTAACTTAT
GTCGTGCTTGCGCTACCGCTCTTCAACCTGATTTGCGCAACGTAATCACAACTTGAGCTCGACGGGATTTCCTCGATGGGGTTTTCTCGACGGGGTTTAG
GGTTGACGGGTTTTTGGGGTCGACGCGGTTTGCATGACCGGGCGTATGAACCGGCTCGTCGAATCAGCCAGAATTAGCCTGATTCCATCGCCGGTATGCG
TGTCACACGACCCATCATCCTGTTAACCTCTCTGGCCATTCCGACGCGTCGTATTCCTTCCGTCTCGTCGGCTGCCGTCTTTCCCGGCACTTCCCGTCAC
TCGTTCCCTGGCGCGACATTTCGTGGGGTGCTATTCCACAGTTCTATTACGCCAAATTGCCTTTTTACAAGTGATCTACCTTTTCTTTTATAAATTTCAT
AAATTTTAAGTATGTTGCTGCATCTTTCGAATGGTAGGAGCCAGTGAAGACGACTCTGCAGCAATAATAGTGTAGCCTTGTCGGCCGCCAGCTCCCAACG
CGTTCCTCCGGGTGTTACTCATTCCAAAATGCACTAGCATACCCTCGTGGCGAACGCATCCTCTGTGCTCACGATGACACTGTAACCAACTCAATCCGTC
TTAATTTCTGATGTCGGGTTTGAAAATAATACATTATCAGCACTTAGAGATTCCATATTTGACGAGTTTTGGCGAGATATGGTTAGGACCCGCATCCAGA
AGGGATGGACAGAGCTCGGAAAAATAATTATTTTATTTATTGAGTGGGTCAACTCGCGTCAATAAATAATTGGGCAATAAACTATTGATCATCAAGTAAA
ATGGAAAAAGTAATGACTAGGTCATGACCCAATGACCTGGTATCCGCAGATACAGCCGTTCTTTGGGCTGTTACCTGCGGGTATCAGCGTTTGGGTCATG
GCCTACCGAAATACCACGCGCTCAGGCAAATAATATTGAGGTATTTGCTGCAGACTCTGCGCCGTCCATAATATTAAGGTATTTGCTGCAAACTCTGCAG
AGTGAACTCGCACCCGTCCATGCGGATCAGATGACATGAAGGAGACCCACGATGCGCGCCCTATGCTTATGTCTACGTCCAAGCACCGCGCTCTGCGGAA
GCAGAGCACGCGCTCCTGGTGCTCGCTCCGCGCCGACGTCTGGGGCACCTACACTACCGCACGTCGTCCAAGCCGTCTGCGTGCTGGTGCTCATCACTGT
CAACGTGGAGCTGTCCATGGCCTCGCCGATCGGCGCCGAGCGTACGCTGAAGCTGAGGTGGCGGAATGGAAAACTGACACATTCTCCCAATACTGACCAG
TGTGTGGTTGTTGTTGTTAGTGTGTGTGGACGCAACGGTGACATCGTCTGGCTGGTACGAGGTGTCCCTGTATGTGTCGAGGGCACTGTTCACGGTGGAG
TAGCCTCTCCAGTTCTGATCGTGTCTTGAGATCGATCCCCGCGCGCACTTGAGACGCACGAAATCCTGCTCATTGTTGGGGACTACAAGAATGTGGCCGA
GAACGCGCTGGCCCAAGGATTCGACGGCGTCGAGTTCCACTGCGCCAATGTATACCTCATTAAGCAGCTCATTCAGGACGGCATCAATGACCGTACGGAC
GAGTACGGCGGGTCGGTGGAGAACTGCGCGCTTCCCGTTCGAAGCTCTGGACCCGATTCTCTAGGTTGTAGACTCGGGTCGAGTCGGCATTCGACTGACC
CCGTACGGCATAAACTTCTGCCAGTTCAAGTCCGACCCCGTCGACTTGTACGGCCCCGTGCTCAAGTGACTTGATGCCTACCACCTGGGCTACTCCCACC
TGATCGAGCCGCACGCGTTCGAGTTGCACGAGAACCCGAACGTGCCCACGGACTGATGCATGGTCTGCACCTCCCGCGAGATCTGTGACGGCGTGATGCT
GACAGGCTCGGGCTACGACGACGCATCGATCATCAAGACCATGAAGTGGATGTTTTGGCCCATGTATTTTGATTGAGCTCGTCGTTTTACTCCAGTTCTT
AAGCAGTACGTGGTTCACCGCGAGGTAGGGAAGAACTGGAGCGTACAAACGGACGGCGTCATCACATGCACCAGTAACTGCTGATGCAGCAAGCAGCTCG
CGAGCATCAACGGCGAGTGCATCGACACGCACCACAACGACGTCGGTTCTGTCGTCCAGATTCGTGTCGTTGAAAGCTGTGGAGGAGATGCACGGTGGCA
TCATAGTGCTGCTCACGGAGGCCGTCATGCGCAGCGAGAAGGTAGGTAAGATCAATTTAGAGAACGTGAGGATACATCCATGATGGAAAAACTAAATGAA
GCTAACACTCAGATCGTTCTCTTGCTACGTAGGTGCTTCGAGAATGCGTCGATACTTCGTTTCCCTTGATCTGTGACAGCGTTTTGAGCGCGCTTTCAAT
GGATAGACCACGATTAACTAGTGAACGTACATATTTGATCACATAGTGTCGTCTTGAGTAAAACTTGGCTTCTTTTGACGATGAACGCCACTTGCAGCCG
TAGGTTTGATCAAGGTACTCGATGGATGGGTGAGTTGATAACCCGACATGCCATTCCGTCCACAGCTCACTAACAGTGCTGATGCCTCTGCTCATTGAAT
GCTGTGGTATGGTAGTGCTTGCTGGATTGCGAATCACGTCGCTGGTGGTGCTGTCGGGGACGTCGCTGCGTGCAGGCTCAGAAGCTCCGATATTCAGGGT
AGGATTAGCTACTGGCATCAATTAGAAACTCATTTATTCACGTAATAAAGAGGTGAGGTTGCTGTTGGTCTCAGAGAGTAGCCGTGCAATTTCTACATGT
CGAGTCTCTATGCCTTGCATTACTCCTGTGTGTTGTCTCGAAATTTGCTCGGATAGCAACGGCATGGCGACTTGAAGTTGCATCTCTAGCGGCGGTTTAG
CGCTTGCTGCTTCTGCTAGTGCTTGCGTCCGAACGCGATAAAATGCCTCCCCCAAAATGTGATGGTAGCTAATTCGAGTAGGAAGCAGGTCGAACAGGAC
AGCACAGTCTTGCAGAAATACGACTCGAAGGTATTGTAGCAATTCTAGAAAACCCGCGCTCTCACAGACACTGCTGCCGCATACGAGCGGATTGAGACTC
CCGAGCGCTTCCCCATGTTGATGATGTTGTGTTCCTTGTGTCTAGTGCTTTATGATTATCTCCGAATGAAAACAGCTGAAACCGATATTTCGATTAGGTC
CTAAATTTGGTGTTGACTCGGGTCAGGACCCAAACTATAGCAATCGTGATACTCATAAAGTAAATCACTAATCGGCTACCTCCGCTCGTTATACGACCAC
TACACGTTCTCTCTTGCCAGTCTTGAGTGCGCCCGCTATAAGCTCAGCGTCCCAAAGCTTCCGTTGAGCTCCAGCATCACCAACGTCTCGAGAGTCGTTG
GGTGCAAGATTTGCCGGCGGTCGGTCAGGACTAATCCCGTCCTCGCGAATAAATGTTCAATGTCGGTAGAATCCAGCGAAGGTCGATGAGCGTGAAAGCG
TATTGCTTTTCACCCGGAATAGCCTCTCTGCAAAAGAGAGATTCTCGCCCTCTTCATCGTCACTTGCATCACTCTCTTCTCTCTACGAAATCGTGAGAGT
GATCGTCGACAGCAGTACCAACGAACGAGTCGAGGGTTCTTGGATGCACTGCTCGGATCTCGTACTTCGAGAGGTATGATGTGTTGTGGTCACGTCGGAG
GTGCATAAACGTTCTAGAATCTGAGAAATACTGATTATTGGGGTCGACCTGTAACGGGCCAGGTGTGTGTCCGTTACTAGCTTACACGTAGCGGTGAGGA
AGCATAGTTTAGACTCGGATTTAGTGAGACCAAGCAGTCAATCTTGGGTAAAATCAACTCTGTTTTATGTAAGGACCAGGGCGGTTACCCCTGGTCTCAT
GTGAGCCACTCAAATGCACTTCATCGGCCCGTTCAAGGTGAGCAAGGTCCTCGGCGACGCGTACACACTGGACATCCCGTCGTCGCTGCGTCTTCACCCG
ACTTTCTACGTCGGGCACCTCAAACGATATCATCCTGCCGATATTCCGACCTCTGATCACCAGGATTCACTGGCGGGTAATGTACCCGAGACTACTCGCG
ACACCAACACCCATCACCCAAGCCTGTACCGTCGCGATGGTCCTCCTCCGATTGTCGACTCGGCGGGTGAAGCGCGCTGGATTGTGGACCGCATCGTTCA
CCACGAGGACCCATCTCGTGCAAACGGGCGTGGGCGTAATCCAGTCCGAGCTCCTCGTGCGATCCCAGCCGCGCGACGTTACCGAGTACGCTGGCTTGGG
TTTCCACCTGACGAGGACACGTGGGAGATGCGTGCAGCTCTTCTTCGGGATGTCCCCGATGTTGTTCATGACTATGAGGCGAAGGTCGCCGCTGCTGAAG
GGACCACGGAGCTCCCGCGGAAGCTGGAGCCTTAAGTGAGCGTGATGATGGAAGTGGACCCCCACCGCAAGCTCGCGGTGGCGTTCACCGCGAAGACTAA
GAAGAAAACCCGACGACGACCGCCGGACTCGAACCGGTGACCTCCACCTTAGTGGCGCAGCTTTCGACCATTGCGCTAGCTGGACTTCGAGTCCCCACGA
CGACGCGCGGACCTGATCAAGCTTGGAGCGACTGCGCATGGCAATGGCAAGGAGGATTCGCGTGGGGATCGAACCCACGCGTCACAGCTCAGCACGGTGA
GCGCTTGCCCACAACGCCGCTCCACAGATGATTGCCGGTGTCGAAGATGTCCAACCTGGTCTCGCTGCCACATCGTTTCGAGTCTACGGTTACGCGACTC
TTCGCCGGGAGTTACTTCGAAGGGTCGTCGCAAAAAGCCACGCCACGCTGATCGCCATCCTGTGTCTCGACACTCGCCGGGTCTCCGCTCTGTGTGCATC
ACAGTTGCGCTTGTCGTCAAGCTTTGGTATCGCTTCCCATGCTGCGTCGTTTCCACGACCGCCGTCCATTCGGGTGTCCGTGGATGTCCGCAGCCACTTG
GGGCGCTGCGCGTTGCTTCGGCGTGTGCGCCGACGAGATCTCTTGGTGTGTGTAAGCTTGCTGCGCCTGCGTCGTCCTGTGTCGCTCGGTAGCACGAGCG
CCGTCCCTCCGCCGCCTCGGTCGACCATGGTGTTCTTCGGGTGTTCTTTCGGAAATGTGTCTTTTGCGCTTACGCAACGTAAGCGCAACTTCGAGAGGGG
GGGGGGGGGTGATGTAATGGGCCCCATTTACATAAGTAGGTAGATTGACAGTACATAAAGTAGTTAAGTCAGTACACGGCTAGCGTGTACGGACGGTCAT
CGTGATTGGCTCAATTGGGGGAGCCAGACCCCATTTCAGCCAATCAGCTTGTTGGCACCGAGGGTGGTCACGGCGGAGGAGCGGATGCCTTCGGTAGACA
GTAACACACGGTCACCCGTGCGAAATGAAGTCTTGTTCTTGCGTCCACGCTTGTCTGCATTCTCCTTCTGCCGGTCCACTGCGGCTTGCAGTGCGTCTCG
CACAAACGTGTGATTGCTTGATGCTGCTCACAAACTCGGAAACCACCAAGTGATCTGTGGGACTCGCCGAGAACTTCGGTGCATAGTTGGCGGTAGTAGC
TGGTTGCTGGATCGTCGCTGGAGCGCCAGCGGGGTCGATCGGAGTTCGCTTTGTCCAGTCTGCGAGCGGCGTCACCGCTCGCAGACTGGACAAAATTTGC
GCTTGATTCAGCGTGGCGACGCCGGTGAATTGACGGGCGACGGCTCCGCCGGCGTGGTGAGTCTTCAGCGGTAGCTCCTCCCCCACCAAGCGTAGAAACA
CGAGCCTCCGTGTGTTGGCCTACGGCAAGCATGGCGGGTACGCGCGGGTGGCGCGCGGAGTTCACGAAGAACGGAGTCATGCCCATCGACGAGTGCTCGG
CGTTGTTCAGAGCGAACTCGGTCAGGGGCAGGAAAGCGCTCCACCTCGGGAACGACGTAGCGTAGCTGCGGAGCACGTCTTCGACGACGCGGTGGACGCG
TTCTGTAACGGGGTTACACGAGAGTTACCCGAAGGGTTACGAAGTGGGTACACACTGTCTAACCTAAATCAGTAGGAGAATCAGTACATGGCTTCAGAGC
CACTGATTATGCATATGACTAGGGTTCACTATGCTAGATAGTGAACCGGATACATTTACACCGTAGGCGGCTTTGCCGCAATAAATGGAAATACATTCAG
TTTGAGATTTATACACTTAAGAGTTAAGGGTTGACTCTTGGAGTCCGTAAGGCACCAACTCCTGCATCCAACACCGATCGCCCATTCGACGTCGTTCACG
CGGATTTGGTGGGGCCATTTACTGGGGACTTCTACTGCTTGACGGTGATTGAACAGCAATTTCGCTAGTTAGAGGTCCTGATGCAGCGCGGCAAGACCTC
GGCAACTACGGCTTCGAGCTTTGAGCGCGTGTGGCTCTGCCGTTATCCTCGCCCAAAACTGGTCGTGCATGACCAAGGACCTGAATTCACGGGAGACGAG
TTCCAGCTGCTATTGACCCCGATGGCGATCAAGGACAAACCGATCACCGCAAAGAACCCGCAGGCCAACGCGATCTGCGAGCGCGTGCACTTGGAAATTA
TGAACATCCTTCGCGTACGCCCGGACCTGCATGATCAGCTGGAAGTCGCCCTCAACTATTCTGCCTACGCCATATGGGCCAGCTATCACTCCGTACTTCG
AGCTTCCCCCGCTCCATTGATGTTTGGCGAGGACATGATCACGCGCGAGTTGCATTTCGCCAACTGGAACTTCCACTCAAAGCAGCGATTCATGGCCATC
ATGCAGGACAACGATCGTGAAACTATGCGGCGACTGCAGCACTTCTATCGTGTAGGTGACAACGTCATGCTCCGTGCCCCTGCTCGTGAAAGGAAGAAAA
CCGACCCAGTCGCCAAGGGCCCGTTCGTCGTGAAGGCTGTCTACGACAACGGCATTGTGCTCCTCGACACTGGATCAAGCGAGTACCGAGTCAACATCAG
GCGAATCTTCCCGTGTTGATTTAACAGCACTGACATCCTGGTATGAGGGATAATGACAACTCCTTCTGCACCCTGTCGACACTAGCGCCTGTCCTCCCTG
GCGTAAGGGTTGACTTCATCTGGGTTTCGTTCTGGGTTCGTTTGAACCCTTGCTTTGGGTACACACGGTGCCTTCAAGGCGCTACATGAGTAGTCTAGCT
GCTAGGAGATGCCAGGAGTAACTTCATTCAATCAATCAGTTCTCAATTCGACTCACAGGACTCAAGCGGCTTGGCAGGGCGACAACTTGTAGACGCGTAA
ACAGCTTGGCCTTGTCGCTCATTTTAGGAGGAGGGGGGCTCGAACGTTGTCGACAAAATGCGAAGAGAGAGTTTGTGGTTGATACCGACTCGGTATCAAC
CACAATGAAAAAATCGTAATCTCACTGACAGAGACGGCACTGCTTAGATCACCATTCATATGCTGTCGATCGCCAGCAATGTTGTCTGATCGAAGTCAAT
CCCAAGATATGTTGCTCACGGGAGGTGATATCGTTCCCCGCTAACTGGCAGTTATTAATAGTAACTGCAGCGAGGCTATTTACAAATTCCTATATTAGCC
GTACAGATGCTAAAACCAAAAACGGGCTGCTGGTACAGAAGTATGCTTTTGGGATCGATTTGCATATTTTGACAAGCGTTGGTACTTGTTAGCATAGTTC
GTATGGGCTTCCTGTTTGGAGCCCCAGACAAGAACTGCTTCGCGAGCGTACTGCGCTGTCGATAGCTCCACCAGCTCTGAAGGCAAGTCGACCACAACAG
TGCAATACTTGTACTCACTGTCATAAGCTGCATACTAAGACGTAAGCACGATTTTACATCCGCTTAGGTTGTCATCGATCCTCTTTGGAAGATCATCGAT
CCGCTTCGGTAGTGTCATCGATCAGTTTGGTTAGATCATCAATCACTTGTGTCGAGCATTCGTAAGACAGTTTGACGACAACTCAAATCTAGTGATTTGA
TTCGCGAATAGTACGACTTGCCAATTCTGTTGGCACTGCCAGGCGCAGAGTGCTCGCAGGTTCTGCTAGGAAGGCCCGCGTTCCTCTTCGCTACTCTTTT
TGATGCATTTCGTTGCACTTCGTATCCTGACTAATATCGGGCGCAGCATAGTAGTGGTAGTAACGATTGGCGGTTCGATAGAACTGTGCGGAGGAGCGCT
GCGACACCAACAAACTCCCTCTACATATTTAAAAGACCACGGCGAGCTTAGATCGTTTAGATTTCCTAGTACTACAGTAGCAGGCCGAGAAAACTGGTAA
GCGCCTTCAGCCGGGCTGATCAATTACTTTAGCTTTGGCATTTTTCATGTATTCCCGAGAAGTTTCGCCGCTCATTTGACTCTTAGAGGCCCTCACGTCG
TTTTGTAGTTATTTGTTTGCGACACCACCAACAGCTTACCTACACGTGGCCGCGGGTGAGGTCGGTGGTGTCCACTACCGACGTAGGTGGAGCTGCAGCA
GTGTGCGCCTCCGTGAGTAAGGTAGCCAAGCAAACCGCAACAAATACAAATACAAATACAAATACCAAGACTGGCTGACGCTGCCTTGTTGCTACTACAA
AACAGTTCATTTCATGACTTTGGTAAGATCCCATAATGTATTGATTGTCTACTCCCTCGCGTCCTCCGACAACGCCTCGGTGCGGAGCATGTGTGCGCGC
TCGTCGTGCACTGCTTCGCTCGGAGGCGTCCTCAGAGGACACGACAGGGTTCGTGGGCCGCACTACCGGAGGAAGAGGGGCTCTATTTGGTTATGCATTA
ACTAGAATTCACTATAAAGCCCTGAACGTTTTGTTTGTCAAGCTGGGCTAATGGTTCGGGTGCATTTATTTCTTAACCATTCTCAAACAAGCGTGTACAT
TGTAGTTGGCAGTAGGGCCGCACTACCGACTACATGTTCGTGCTTGTGAGCGCCTTATTTCGTCGGCTCGACTGTAGGTGGCACGAGCAATTCAAAAACG
GCAAAGCGGTTGTCCTCGGGTTCCTACATGCTCAACGGAGGAACGCACGCAACGACACTATCCTCTGAAAGTTTTGGCCAATCGCATGGTGCAAATTGTT
GTCCGACAAACTGTCTTACGTTTTGACGGACAAAATACAATGTAGCCACTGGTATACTAAAACCAAGATGTAGCCAAAATGCGTTGATTGCAAAACGTAA
GACGCTTTGTCTTACGGTAGGCTCTCTGGGGCTAAGTATCGTCTTACGAAAGATCATCAATCTGCTTGGGTAGATCATGGATCCGCATTATCAATAGAGT
GTCATGCATTTGGTTGGCCTCTCATGAGCCTGCAGTCGCCACTATTTTGTCTTTTTTTCTACATGTATCGTAAGGCATTTTACAGCTGACGATAAAGATC
ATGTATATGGGTTTCGCATGACTTCTACCTAGCTTTCACGCCTATTCTGAGGTCTACCGATAGCATTCTTGCGGAACTTACTGGTGGGACTTAGTAAAAC
AAGACACAACCGACCACTGCTCATAGCGAAGACTCAAGCCAGCTCCCCGCATACTTACACCCGAGATAGCTACCGTCTTCCCTCGGACTAGACGCCTAGG
CGTTCTAAAAAAACTAGACGCCTAGGCGTTCTATTCAAGTGAAACTGCGAAACTCTGAAGGATGCAAAAGGTAGGCGTTGTATTCAAGTAAATCTAAAAA
ACCCGAAGGTTGGTAGTGGCCTCTAAGCTATATCCGCATTCCTGCTACGTGCAACGCAAACTGAGGGCCCAGTCGAGCAAGGCATATCTTCCCAGTTGCC
TCAGGAACAGTGTAGGTGAACTCGGAAATCACTTTGCAGTTGTCGTTCAAAGTTTTCACTTCAATGCTGCACCTGTGCAATCTGGATGCTGCAAAAAGCT
CCAACTCACCCCATTCAGCAGTTCCGTTTCTGATCGACTCAATGTAGTCGTGGTCAAGTAAGCCTGTCAAATCTTCAAGTCCTGCCATGAACTCCGTCAG
CAGCGTGATGTAGTCGGCGATGGAGGGTGCGAGGCTGAAACGGAGGCAACGATGAAGACTTGATTTAGTCTCCTCCGGTAGATACCACTCAGGTGGGTCA
ATGCAAACCTCTTCTAGATCAGCTTCTTCGTCAAGCAGAGCCTTGTATCTGCGGTGCCATTCATCCAAATCAATACTCGCCTCCAACAGCTCGCGAAGCG
GAGGGTGGAGGTCTTCCACATCAAATGACTGTCGTTGAACAAGGCCACAAACTCGAAATTCTTTTTTGATGTCGGTGGCGTCCTTCATCTCAATCCAGTC
CAGAACGCATTGAGATACCGTTCGATAGTGAGGAACCTTAGGGTTACCCTGCTTTGTCTGCAAAGTTGGATCGATCAGCGCTTTGCCTATATACTCGTCG
AATCGGTCGTTGTAGAAAGCTTGAACGCTCCTGTTTAGAGCCACATCGAGCGGTTGGAGTAGATTTTCATGATCGGCGGTACCAATAACACGAAGATGTT
AAACGACGAAGGTTTTGTTCATTGAACAAATTCACGTGACATCCATACGAATCAATGATGTAAAGCACTGACTGCCGATAAAATCGAGTCTCCGCTCGGC
CGCAAATTACATGTTCTGCATGCTCCAGCAATATCTGATCGTTCCACATCCCTGTTGGGTTAACATCAACCATGATGTCCTTCGAAATAGCTCCAAGTTT
TGGCTTATTTTTTTAGCTGGGAGAAAAGCACATGGGGCTTTAAGAATTTACCGTCTCCAGTAACCGCGAACGTTGCTGTAAAGCGTTTGTGGCTGCCCCC
CTTCCGCGAGTTGCGATCGTCGAATTAGGTTCCGTTTCAAAATATCTTGGGACCTGGTCCATGTTTATTATGTTGCATGGATCGATGTGATGCTGCTCAA
TCAGAGACTGAGCTTTCTGAATGAACTCCTCGCACACACTCTTGGCATCAGCAGGTAGTGTTCGGGTAGTCGTCTGACGCCTCGACACCAAGTTGTAGCG
CGTCTTAAACTTGTCTAGCCAACCCGTTGAAGCCTTGAAAAGATGATATTGCTGCTCTTTAAAGCCACGAGGATGTTGAGATTTGTAGCTGGATGTACTT
GTCCTTGACCCGCAGTCCCTTTTTGTTTCGCCCATCGACCCACTCATGAAGCTGCACTTCGAGTTGCTGGTATTCATGCTTGCGACCCGCACCAGGCAGT
CGACGCATCGTCCGCGTTGATCGCTGTCTGTCCTTCGCAACGTCTTTCATGGCGCCCAACTGCTCAACCCATTTCCGAACTATCGATGACGAGGGTATCT
TGTGTTTTGCGGCAAGGGCGGCAAACCCAAAGCCGTTGACACCCTTCTTGTACTCT