Description :
From Genome Similarity Track
Location :
Scaffold_179:2331- 6398
Transcript NameFunction/comments
Physo_159049PsAvh72
Physo_144313hypothetical protein

Sequence
4067 bases(100 bases per row)
CATAGTACTTCTTCTTCTTCTTCTATTACCAGTATTAGTGGAATATTAGTGGAATGCCTTTCGCGGGCTCTTTTGCCAGTGTAACGCTTCCATCCACTGC
TATTTTGCCCGCCCTCGTGATCAGCTACATCAATGTCCTCTTCATGCTGTAGCAGCGGCTCAGCAGTAGAGCTCTGGCTGAGCTCCAGTGCAGTCTCGTC
CTCCAGCAGTTCAGTGCTTGTTGCATCACTAGAGAAAAGCCGTCCGCATCCATGCCTTCTAAGTCCCCCCACACGTCACGCATAGCCTCGTAGCACCCGG
GCTCCTTCAGCGGCTTCTCGGTGGCGTTACCGGTAGCCTCCAGAGCAACACGGTACGCGGTGTACTGCTTGTGCATATGCTTCAGCTACAATAGGATTGA
AATGAAGTGAACTCGGTTAGCATTAACAAGTTCCTGTCAATAGTTTGTCATCATACACACCTTTGACTTGCACTGCTCTGCATCAACTTCAAGCCCTCCG
AGGCGGAATGTTTCGGCAGCAAGCATTTTCCATGCCGCAGTAAGCTGCTTGGGGCTCCTCGTTCCCTGAAACCAACCTCTCATGGTATCGTAGCGAAGCC
GCAACAGCACTTCGGCCGCTCTCGGTGTCCAGGCAAACGACGGCTTGACGTTAGAAGCTCCTTTCAGACGAGACTTGCCTCGGCCCTGTGCTGCTTGCGG
TGCGGCCGAGGCTTGCAGACGCTTGAGCATGCGAGATGGAGCGGGAGTAGGCTCTAGCGTAGCAGACATCGCCACTGATACTTGAGGTAGCGGAACAAAT
GTGGACGCAGTCTCGGACCTTCTAGCAGCAGACCTTCATCACCGGCAGATGGTGTCAGCGAGACGAGGGGCTCGAACGCTGGCGTTTCGTCATGACGTGC
GGGGGGCGCAGGAACCGACGAGCCTTGAGCAGCGGCATGTGCCGCACGCGTGGCCGCACTGGTGAGGCGAGTCGGCATTTTCTCAAGTGGGGAGGAGAGC
CATCCCATATCTGTCCTGTGATTGGCTTAAAATTTGTCTGGAGATGGATACGTAGCGAACGAGCTGTAGGTGGAGATCAAGCACCATCTCCATCTCTAGT
ACAACGCGAACAGGCTCTAAGCAAGAGCTATCTCAATTCATGAGAACTCCCTTATCCTCCGTCGTAACCGCAAACGTAAATAAGCTAATAAGGACCCATG
ATGCATGGTACCGCTCCGAGGTTGCACCGCTAAAATTTCACGACGGGGTTGCGTAGCAGTAGAGAATCGTTTACAAGTTCCGAGCGTACAAGAAGGCTAT
TATAGTCAAGATTTTCTGCTCCACTCTGCTAAAAAAAAAGTAAGATCCAACGACATGAAGGAAACACGGGTTCAAGGTGAAAAGATTGTCTGCATTTTCT
CTCAAGTGTATTGCAAGGACGGACTGGTACAGACGATTCGAGAACTTGTCACAGTGTCAACTCCCCGACGGTCTCCATGCACGTGCCGCTGGAGCATGTA
TCTAATGACCTCTCAAGTGGAATCCATACCAATCGACAATCTTACTTTTGTCATAATCGGTCAGCCCTTTAATTTTCGCCAGCTTTTTCTCGATGTTGGA
CTCAGTACGGCCTTTCGAGCTCCATTTTTTAAAAAATGAAGTCCACTTTCCGTTTCTCAAATCATCGATTTTAAACTGCTTGTACCTCTCTTCGCCGTCA
TCGACCGTGGCCCGAAGGGATCTCTTGCTCTCAGTGGTGAGGACATCGACCAACGTGTCGAACTCCGCTGCCGCAAACTTCGAAACGGTAGCCTGGTCGG
CGTCAGTTGCTGCAGAAAAAGCGTTTTCGCTTGCGAGAAGGATGGCAGCAACAGCCACGACGAGGGTGTTGGTTGGCGCATTGTCGCTTGGTGGTCGGGC
TCTTGATAACTGGAAGGAGAAACGCAGAATGAGATTCAAGGTCATCGTGGTCTGGAGACCGTCACAGTGTGATTCGTCAAGTGACGGTAATACATATACT
GTACATGTCTATTAATAAGACTGCATCCAAACATCTCGTATGTACAATAGTGAGTCCCTGAGACTGAACTTCGTTGTGGCGATACATGTACGCCTAGGCA
TTGAAGATTTTCTTCAGATGGGCATTTCAAGCAATGTTTGAATGAAAAAGATATCTTGCTCTATCCGCCGTACAACATTTTGCTTGTACTATGGTAATAT
TCTACTGCAGACGGCGCGGCAATACCAATTCTCAATTAGACGTCAGCAATTGCAATTTTGAAATTTTCCAGTATACATGTATTAGCACGGTCGTCGTTTA
GTTTACCGGTAGTGTGCCTTTCCAAAACTTTGGCCAATCTGACCTCAAAAAAGGTGGTCTTAAGAAGGAGAGGGTGGGGCCCAACCTAGGATTTGCTGTT
GGCCTTGCATCGGAATACGAAAGTCCTACTTTACGTAGGAGCTCCGTCTTCACCTAAAGGGTACCGTTTTGGAAGCAAGGCCCGAATGGCCACGTTAAGC
TGGCCATTTGGACCTTCGTAGGACTAACGAGTCCTTCGTAGGACTGGATCAGGCCAGTGCGCCTGAAAGCATCTGTGGCAAATGCATAGTTTGGACACAC
TCGTACAGGCGGAGACTCAGGCAGCACCGCACCCAGGTCACCGTGCTCAGCGTGGAGCTACGTACATGTGCTACAGGTATAACGGTACTGAACGCGCTGA
CTTGTCGGTCTACCTTTGCAAGTCATTCGCTCAGTTTACATTCAGTTTTTGTTTATACCAGGTTTTACTGTCCTCGGTACTAACTTTTATGAGACCTTAC
GTAGGAGCAAAAGTCCTACGTAGGACCTCAAATCGGAGGGCGTTTTGGCAGAAAGTGAGAACCGGTTAAAACGCCCGTCTGTAGTAATCCCTTATAAGAC
CTCAATCACTTAATTAATCGGAGTGCAAATCAGGGTTTAAATCGACTGTGATCCATTTGCATCGCCAGGCTGCACGATTGCCCAGTGAAAGGTGGGTATT
CTGCTCCAAACGCGTCTATATCGACTGCTCGTTCATAAATCGATCGTCTAATCTGCACACCAACTCACATAATATGCATATTATGCATCGCAGGGACGCG
ATCGATTTACAAATCGATCGAGCTAAATAAGGGTGCTAATCGATCGATTTTCGAGGTTATCTGATTAGTATTTCTTACGCTGCCGTTCGGTGCACTCGAA
TACGGTACAGGAACACTTCATTTTAGGACCGTCGCATAAGCTGCGGTAGCCTCGTCGCGCTGCATGAAAACTGTCCGTAGTACCGTACTTTGAGTTTCGA
CCAGGAAACACCTCCGTGCCAGACCACTGGTCCATTGCATATCGACTTCGAGACACAGGGCTTGAAAATTGCTCAAGTTGGTGAAGCCAGAAGTGAGAGT
GATTATATCTGCAGGCTTGGCTTGATCCCCTCATTTAAGTTTGGCCTCCTCATGTTGACGACCCTAGCTGTTGACGCAGTGTCTCCACTTCCCATTGTAC
ATGCCGTATCGCACGATTTCGTGCAAGATCAAAGACAATAATTTGACGCGAATCGAGTAAAAACATCGAGCCGCTCGATTCTTTGCTGTCTTCATCGTAG
ATTTTAACATCTACGATTTTAACATCTACGATGAAGACAGCAAAGAATCGAGCGGCTCGATGTTTTGGTATGTATCGCCTCCCTCACGTCGCGCAGCAGC
AGCGAAGAATACGAGGCCACCCGAATATTGACAGAGTGGAGGGGGTACATATTTGAAAAAAACAAGCTAAACGAAAACATGAAGTAGTCTTCATCGGAAC
AGCATCTTCACATCTAACATCTACATGTAAGCTTACTCGGGGTATATTTTAGAGAACTGCAGACGCGCCCTCGTTTGCTTGACGCGTGTAAGTACATGTA
GCGCAGAGGGACACGAGGCGGCTCAAATTGCTTTGCCCACCCTCAACCAGCAACCTGATCCACTGAGATAGGTTATTTAATCTCAGTGGTCTCGAAAAAG
GAAGGTTCAGAAGAGGTAAGAGGTCTAAATTCTAATGGCGGCAGTTGCGAAGCGCCGGCGCTGCGTG