Description :
From Genome Similarity Track
Location :
Scaffold_1526:2331- 4729
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1526-fgenesh-gene-0.2Ubiquitin carboxyl-terminal hydrolase and/or F-box protein

Sequence
2398 bases(100 bases per row)
TTGTTGTTGTACTGGTAGAACACGGGCATCATCTCGCGCATCGGGTGCGCGACGCTGTGGTCCTTGAAGTTGTAGATGCGCTGCCACTTGCCGTCCACGT
TCGCGTACCGGTGGTTCACCTCGTGGCATTGTGCTGTTGTCGAAACAAATATCAAACAAGCGCAACAATTTTCATCAGCACGCCAGCAAACGAACAAACA
AGACGTGCACACATACACAACACTCACCATTGCATGCGCGGCACAGGTCGTAGTCCGTGCACATGGAGCAGTTGAAGCGCGGGCCCTTGAAGTCCGTCTC
GCCGCACGAGTCGCAGATGAAACCCAAGTGCCGGCCCTCCATGATGTACTTGAGCGTGCGCTTGCCGTCCTCCTTGCACTTGCGGAACGCGCTGCGCACG
CGGAACTTTGGAATGTCGAGCTTCTCGGCCAGATTCTCAATGGCTTCGAGCGTCGGCACGACTGCAAACGGCCGCTCGGCAAGAAGCTCCTCGGCGTGCA
AATACTGGGAGAGCAACAGGCGCTGCATCGCGTTCGCAAACGCCTGCTGGGCCGCCGGCGTGCGCAGTGTGAAGATCACAATGTCGGCTGCATGGAGTGG
GAACTCGAGCGCAAGCGGAGAGATCACAGGATCGCTGCACCATGGAATGGGGCCCGAGAGCACGGTCGGCGCAATCTCTTCCTTGTACATAAGCAGCTCC
GACGACGAGCAGCTCAGGCGCTTCGCGACGCACTCGTAGATCGCCGCCGAGGAAAGCTGGGGCGCAAAGCGGATGCGCCCAACGTACTCGAGCTGGTGCG
TACTTGGGTTCATGATCTTGACAAACAGGAAGCCGTCCGGGATCCCTGCTGCTGGGCCACTTGAGGCCATAGCGTCCAGCTGGTTGGATCCATTGCTGCT
GCTGCTGCGCTCGACTGTCATCATCATCATAGCGACGTCCAGCGGCGGGTCGTCCTGGCTCTTGCTCTCCACATAGATCTGGCAGAACGAGTACGCGTCA
ATGTCGACGCCGTCGCAGAGCAGGTTGCCAAACATGGGCTGGTTCCGGTCGACTTTGGGTTGCGTGAGCAGCTTGCGTGGCCGGAGCGCCTGGCCCGAGA
CCACGGGCTGATTAAAGCACCAGATGTTCACGTGCTCCAGATCGACGCCGTAGACGCCCTCGAGCTTCGCGAGCAGGTCCTGCAGCGTGCAGCAGAACGG
CAGCTCGAGCGTGTCGACGCGCGACAGATCCGTGAGGCCCAAGTGGCGGTGGCTCTTGAGGTCGCGCTCGCGCACGACGCGGAACGTGATGTTCATCAGT
CGCACCTTGGCCGTGACCGTGAGCGTATCGTTGAGCAGGAAGCCGCTCGCTGGGTTCTTGAGCGTCTTGAGCGCGCCGAGCGAGTGCACGCCCCAGTTGT
TCAGCTGGGCGTCAAACTTGTTGTCGATGAGGCATGAGTGCCACTCGATGCGCTTCGCTGGGTCCAAGTGATTCACGACTGAGAGCGAGAAGACGGCGCA
CGTGAGCCAGCTGGGCGGGCGCTGATCCAAGTCCGTGAGCACGAGGTAGACGCTCAGCACCTTGTTTGCGTACTGCTGCTCGTTCGGGTTCCCATTGGGA
AAGATCCAGAGGCAGAAGCGGTGGTCGCCGATCCAGAAGGTCTCGGACACGATCTTTTCGACCGACGCCATGGGTGCCGCGAAGTTCGGGATCTGCACGC
GCAGCTCGGCGCGCGCGTTCTTGCGGTGCTGCTCCACAAAGCAGCGGCGCCAGCAACCGCCGTACAGTCGAATGAGCTAGTAATAACGCATTCATACCCC
AGACAGCGTAGCTGGTCAGTAAACCGTAACGCAATGTGACTGACAAGATGAGATATGGAATATGTATGTACGTACATCATAGTCGGGCGCGCCGGGCAGC
TGCGGGAGGAACTGGGTCTGCAGCGTCGGCCACTGGGTCATGCAGATGTTGCGCCATACGTCGCGGTCGTAGGTCAGCGGCGCGAGCGTGCGGCACACGA
GCGCACATGCAAGCAGCGTTTTGCCGTCGAGCAGGCTAAGCATGAGCTGCAAGAGCTCCTGGGGCAGCGCCTGCGCAAGCGACAACACCACCTTCTCGTC
TTCATCTTCCACGGCCATCATCATGTCGCAGTCGCTGTCCTTAAGCATCCACGTCATGTAGCTCTCGACCGAGAGCACGGTCTGGTTCATCACGGCGCCG
TCATTCTCGCTGTTGCGGCCAAAGTTCGAGCGGTACTTGGAGAGGAACGCCATGGGGTCTCCTCCACGCGCGCCCACGAGCGTGCGGAAGGCGCCGCCGG
CGCCCGTGCCGCGCCAGTGGCGCTTCTTGGACTGCGTGCCGTGCGTGTTGGTCATGCGCGCGAGTGGGAGCTGCTGCCGAGAGGCGGAATCCAGATCT