Description :
From Genome Similarity Track
Location :
Scaffold_73:2331- 3392
Sequence
1061 bases(100 bases per row)
TCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTC
CCAAGATACACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCGCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCT
TCCTCTGGGCCTAGTGACGGCCATCACCTGGACTGTCCTTTTTTCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGC
TCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACT
CGTGATTCATCCAAACACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCAC
CAAATTTGAATTCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTG
AGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAATCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGG
ATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGT
CAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATTTCGTCTTCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAG
GCGAGAGTAAAGCTGCCCACTGCCCCAAACGTCCTTGAAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCT
TCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATTGCTTTCTCC