Description :
From Genome Similarity Track
Location :
Scaffold_92:23308- 24959
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_92-snap-gene-0.23Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1651 bases(100 bases per row)
GTTCATCATGAAGCGATTCTGCAGAATCTCGAGGTCAATGCGGAACTTAGCGAGCTCCTCGTCCTCGAGCATGCCGTTGTTGTCCTCGTCGTAGACGTTG
ATGACGGCGTCGACGTCCAGGTGGATGTCCTCCGTCACGGCGTGGAAGCGCTCGAGGATCGCCTCGATCTCGTTCCGGCAGAGCATGCGCTTGCCCTTGA
GGTAGTCCACGTTGGACTTCATCGTCTGCTGCATCACGCTCTTCATGACCTTCTGGAAGTTGGTGCCGATGACCGTGATGGGCAGCGCGAGCACGAGCAT
TCCAGTGAGCACGCTCGCGCAGCCCACAACCTTGCCCGGGAGCGTAACGGGCGTCATGTCCCCGTACCCGACCGTCGACATGGTCACGATGCACCACCAG
AAGGACGACGCGATGCTCTTGTACGGGTTCGGGTCGACGCATATGCAGTTGGTCGACGACGCCGCCCGCGCCGCCGCGGCTCCAGCGATGGACGAGGCGA
ACACGGGCGGCACCGAGTCGCTGCTGCTGCAGTCGCCGACCCAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGTCGCGCGTGTACTCGGCGAAGTAGATCATGCTCGAGAAAACGATCATGGCGATGGCCATGAGGAAGA
TGAGCATTGACAGCGCCTTCATGCTGATCGCGATCGCCTGCACGAACACCTGGATCGCCGACGAGTAGCGCGACATCTTGAGCACGCGCGCCACGCGCGT
GAGCCGCACGATTCGGATCGCGCCGAACGTGCCGGCGTTGTCCACTTGGAGTATTCGCTCCAGGTAGAACGGGAAGATGGCCGAAATGTCGATCCAGTTG
GCATAGTCTGAATGACAATGTACTTAGATTAGTGAGAACTTCAATCATCGAAGAGCTACGAACAATGGTTGGACAGGACTCACTCTGGAAGAACGCGGTC
AGGCTCGGACACGCGATCATGCGCAGCAGCAGCTCGATGGAGAAGATCCCGGCGCAGATCGTCTCGACGAGGTCCAGTTCGTTCATGTACATGGCGAGTC
CGTCCTCGGTCTGCGCGATGAACACGACCGTGGACACGGTCACGAAACCGAAGATGAAGACCGAGAGGTAGTGCGCCGTCTGCGACGACTGCGGGTCGTC
CAGTAGCAACCACAGCCGCTGCCTTCTCGTTGTGGCTGCTACTTCGTCCATCTCGGATGTGGACCGCGCTTTCGATCCCTGGCGATGCAGCTCGGCCACC
TTGGAGCCTCTCGGGAAGTGCTCTTCTTCCAGTCTGGGCTCGTCTTCCTTGGCTATTGAGAAAGCATTGTGCTTGGGCACAGGCGCCACTGACGAAGTCG
ACTTCTTGCTGCCCGGCCGTCTGAGCGAGCTGCGCTGGAAGGACGAGAAGCTCGAGCGCATGCGCGATAGGTGGCTGCTGCGCAGCGCCGAGCTGCGCTT
CGCCTCGCGCTCAATCACCTGCGAGAGCTTGAGCGCCGTGTCCGAGAGCTC