Description :
From Genome Similarity Track
Location :
Scaffold_154:23304- 24590
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15255Hypothetical protein
Sappa_CBS223.65SPRG_15258Hypothetical protein

Sequence
1286 bases(100 bases per row)
GAACGCGCCTTGGCGCAAGATGGACCAGCACGCGTCGCGGACGGCAGCGTCCTTCGTCGGCTCGTACATGTCGAAGAGCTCCCGGATCGAGACGCCGTTG
CGGCCGCCCAGCGCGATGCTCTCGTACAGCATCGGCATGAGCCGCAGTACGCTCCAGCGCGCCTCTCGTGGTGCATCGGTCCGTGCCATGGCCTCGCACG
GTTGGATCCGCAACCACTTGCACTTTTCGAAGTTCGCTTCGAGGCGGCTTCGACTCGGCTGAGACCACGAGCCCACAACCCCCGTAAAGTACGGTTATGG
CTTCGAACTTCGACTGGGATATTTTTGGAATATCAAGCGGCCATGCAAATGCCGGGCCATGCCCTTCGCCGCGCTGGTTAAATGTTCACCCACCTGGGTT
GAGCTAGCGCCCTCGCATTGCTGAAGCCTGATTCCCTTGGTCAGAGTGCTGCTGCTGTCACCGCATATGCAGTCGATGCTACTAGTATCGTAATGGCACC
ACAAGTGGACATTCTGTTGCAACTCAAATGCTTCAAACAGTTCAACGCAGTTCGATTGACATTGCATGTGACGCCTTGTCCATGCCTTGGCGCTGGCTAG
CCTTACGTCGCGTGTTTGAATGCATGCGTCGCCTTGCCGTCGTACACCGTCCAGTCATGACAGCTGGAGCGACGTAGCTTGTCGCGTCCGCCGTGGATGC
GTGCCGTCGCTGGGTGCACGCTGCATCATGCAAAAGCTGCGCCACGTGTAGAGGTCGTCGCGGTAGTATTGGCTGTACATCGGACATGGGGTGTCATGCG
AGCGGAAAGCCTCGGAGTGTGCTCGCGACCGTTCAAGATCGCATGTCGCGCCACAAGCAGCGCGTCGAGGCCCGGCTCGCCGAGCGGTTTGGCATCCGCG
ATGCGCTCGAGGCTTCGGACGAGCAGCGCGCAATCAACGAGATGTTCCAGCGTGTCGCCAAGATTGCCAGCGAAGACACACTGCGCGAAGACGGTAGCCT
GTGCCTCCACGTCATGTTGTGTCGGACGCATACGTAGGCTTCTTCTTTTGCGACGGACAGTACATGGGCGCGCGCCGCTTCAAGGAGACGCCTGGCATGG
TCCTTCAAGTCTTGGATGGCCATACTGGAGCCGTGCGCGCGATCGGCATGAGCGCGGATGTCCTTCTCACCTTTGGCATGGATGGGTACCGACCGCCTTT
CGAAACGTACTCTACATGAAAGGCTCTGTAGCGTCTACGTGTGGGCGCCATCTGCGCCGACACCCGTCGCGCGATTGCCGCGACAC