Description :
From Genome Similarity Track
Location :
Scaffold_25:23303- 30572
Transcript NameFunction/comments
Phyra_77482transcription-repair coupling factor Mfd
Phyra_77483conserved unknown protein

Sequence
7269 bases(100 bases per row)
CTACTCTTTTCTTCTCCCCTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGC
TTCGTCCACGCGGCGCCTTTTCCTCTGTATTTCCTCCGGGGAAATAGTCTTGGACGTGGCAACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGAT
TTGACGCTCGAGTTCCCCCCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGC
CCTCTTGTTGGTCACGTGGAGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAG
CTCCCTCACACCCACGTCTGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCC
GCTGTAGCGGGCCACACAGCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCATTC
CGAAATTGGCATCGACAATTGGACTTCAACTGACTGACCATCATTCTTGTGTTTAGTGTTCTACACCTCAAATAGGTCTTACGCGGGAATAACCGTGCTC
GCCATTTTTCAACGGCAGTGCGCGCGGAACTGAGCGCTTCATTGACAGGTGCTGGCGCGCGAATGGAGTCTCCGCGGCGCCCGTCGGCGGCGTCTGGGTC
TGTACCAACGTCCTGTCTCTCTGATTCGTCATTTTCGCGGCCCGACAGCCCCCTCCAACGCCCGAACGACAGCTTCGCCGAGTCTCAGCAGTGCAGCGCT
GACCCGAGCGCCTTTCTGGGATTCCACGTGCCTCCGAGCGCCGAGGAGGTGGAAGTGGAGCCTGCTCATCTTCAGCAGAAGCAGAAACAGACCCCGAAAC
TGGTGCTGAACCTGGATGCGAGCACGAGAGGCGACAACGGCTTCCGACCTGCGACGTCGTACGAAAGTTCGATACGCACGTCCAACCCGTTCAGTGAATT
GTTTGAAGGCGACACGCAGGATGATGAGAACGTGGTGATAGACCAAGTTGCTGCAGAGAGACGAGGTGAACTGGTTCAGAAGAACATGAAGGAGGTTTTG
CCGTTGAAGAGACGGCGACAACGTGAGGATGACGCAGGTGCAGACAGGTCAAGTCCCCCGCCTACGATGCTGGCGTCGATGGAAAGTGCGTGGCGAGCTC
GCAAACGGAGAGTGGCTGAGAGTTCACTGGACCTGAAAGGGTCGACTGGAGAAGTGGATGCAGCACAGAATCAGAACGGCCAGAAGGATGTCCAGGAAAG
TTTGGACGCAGAGACGATGGATGAAGCACGCAAATTTGCTGCTGCTACTGATGCAACAGTGAGTCAAGAGAGTGCTGGGGGGAAACGCGCTGATGACTCG
CTGCCAGGAGCTAGCGCGTGTTCGGAGTATAGTGAAGACCTTGCTCCGCGGATTTTCCAGGCTATGGTTAAAGTTCCCACCAATGAGTCGATTATTCATG
AGAATTGTGGCAAGAATTCGACAGACCATGTTCAATTTGATACCAGTGCGATGTCAGAAGACAGCGACCGGGAGACCGATTACGAGGATGAACTGGAGTG
TACACAGCAGCTTGACGATGATGGGGCTATTGACGATATGGACATGACTCGCAGCTATGAAATTGGAAGCGATTGCGATGAAGAGGATACAGAAGTATAC
CCTTATTCTGATACAGGCACTTTACCATACGGGGCCGACTCGACCATTCTAGATGATGGCAACGATGACGAGGCAAATCCACAGAAAGAGACTGCGGGCA
GTGCTTCGAGAGAAGAAAAAATGACCCTTGTGCCGACGCCGGATCAAATCAGTGACCAGCGAAGAGCTGAGGACGAAGCAACGAGTCGAGAAGGGTCACA
AACTACCCAACAGGACTATCTGACTCCAAGAGTTGTCCCCAGCCGATCTAAACGATCCGATGCTGCCGAAACCAGCACAAATTTTGTCGTCGCAGTCGCC
CCTAGTGGTGATGATGAGCAGAGCTCGCAGAAGTCCCAACATGACAATGATCCAGATGAGTGCGTGCCTACTCAACCTAGTAAACCTCGGGCGGAGAGTG
AACCCATCGTCGAGCCGAACTTGCCTTCGCAACAAAACGTATCCAAGAAGAGCGATGTGCTTTTGACGAACGAGCATCTTGCTGGAACCGATTCTCAGGC
AAAAGCGATCCGCACACTAGAGTTTTCGTTCTCGATGCCTGAGTCGCAGGAAGGCGAGCCACACTTCAGTGCAAGCCTGCCAAGTGAAGGGGCAGCTGTG
TCAAAGAGATCAGAAACGTTCTCTCGCAGTGACAAAACAAGCCCTTTCGCGTCTTCTATCAGCCCGGTATGGGCGGCAATTCCAACCCCCATACCTGTAG
AGGGTTCTGCCGTTCCCGATGTCACTGGGGTCACGATAAGTTTGAAGAAGAAAACCACATCGCCATGTGATTTGCCGACAGGAAAGAAGCAAAAACATTC
TGCTGAAGGTACCGATTCCCCTAGCTCATCCAAGCCTAAGAGGAGTAAGCGCGGTTTTTTTACACCTGACAGTAGCAGCACGCCAAAAGAATCGGACGGA
GGTGATCCGCAAACTCCTCGGCCTCCTGCCCGCCGCGGCACTCGGTCCTCTCAGTCCACACCTTCATCAACCCCTACAGTTCGAACACGAACAAGAACAC
TAACCCCCGTGCCGTCACAGCGTGCATATGCTTCAAGATCTCGAACGCTATTCAAGTACAAGTTCGAGTTTTGCTTGACGGGCTTCGTGAAGACCGGTGA
AGAAAACTTGAAGGAGCTGATTGAAGGTCACGGAGGCAAAATTCCTGAAAGATACCAGGATGTTCTATACAAAAACAACGTCAAAGCTGTGGTTATCGCA
ACACCGGTATCATGGCGCAAGCGCAAGTTTATGCAAGCTGTGGCATGTGGAATCCCCGTCGTTCATACAGATTGGATTCACGATTGTATTGAAGATGGCT
ATGTGGTACCTTTCGATGGCTATCAAGTCCCAACAGGCTACTCCGTTACCACTCGAAAATTCGAGTGTTTCCCCCCTAGAGAGGTAAGTCCTCTCGAATA
GGTCGAACGCCTGGGATGGTTGAATGCAAAACTAACCTTTTTGCTGCGTGCGGTTGTGCGAACAGCTACACATTTTTGAAGGCTATTCCTTTGGTATTGT
CAGTGACGTGGCACAAACGTCGAAGGCAGAAGCGAAGGACAAGGCCAATCTGATGGCTTTTATTTTGAAGGCTTGTGGTGCAGATGCTGTATACGAGGTT
AGTCCATCGGTATCAGTAACACTCTGTACGGTCGATGTTTTGTCGTCCACTAACGCGTGTCGTGACTTGTAGAATCTGTCTACCAAGAGCGACGTTAACG
TGGATGTGGTGCTCTGCGACGAGTATACTCAGGTATGGAGCATTGATACCAACCATGCTGTATGATCTAGCCGTTTGACCGGTAATTGTGTATCCTTGTG
TCGTCTAAAATATAGACTTGCCGGTACTACAAGAAGAAACGCCGCGTGCCGGTGAAAGACTTCCAGTGGGTTACCGAGTGCATGATCCTTCAGGTACACA
TAGCATGAGATAATCCGTGTGGTAGGAAATATCGTCGATCTGCCAACTAACACAGAGTTTGGCTGTTTCTTAGCGATGTCTGGATCCCGAAGAACCAGTT
TTTGAACCACAGCGCGTAGGCTGCGTAGATGTTTTTGCAGCAAGCGCTGAAATTGGTGACAGCGACAAGTACGTTCTGGGCCTTGTTCTCCACGTACCTG
TGAATGGCTCGCTCATATATTCCTGTTGCGTCTTGGTAGCACGACCCTGAAGTTATACACGGGGGAGCTTGTGATGGCGGACATCTCGGGCAGTGCAGCC
GACCACTACCTCCTGTTCAATGTCTGCGAAATCCTCAGTATTCACGTAAATGCACGGAAAGATGAAGGCTCGCAGTCAAAGAGGAAAGACAAAGGAAGCC
GCGTTATGCTTCGTGTGGGCATGTTGAAACGGTACGCTTTGCTTTGTGTAGTTGCTTGTTGCTGGGCTAGTTGTGTTGACAATGTTGCACTGTGTGTGGA
ATGAATAGCGAGCCTTACAACCCCGAGCTGTCAAAATCCCCCGCCAATGTGCTGGAAATCTCATCATCACAAGTGAAACGAAGAGTGGTGGCGATTTCTA
AGGAGGACTATGGCAAGCTGAAGTATAAGGATGAGAGTATCTTTTATTTGGAGGAGGAGAGCGATCTGAACAAACTCGCCGTGTCTGAGCACAGATGGCT
GACACAGTGACTGCATCGTTGCTCTGTTGTTAATGCTATCACAAAACGCCTCCGCTTCAGGAAAATCTTTCTTGTGCGTTTCACTCGTGTTGCTCTTCAG
GGCCACCCTGATCTCGCGCATTTCGTTCATCAAGAATCATCCTATTGGGGATGAATAGATGGAGCCACGGCTAACAACGCGAAGGAAGCCAATTTAGTAG
GATTGAGAGTGAGGCTGTGCTGGTGCTGTCAACTGGCACGTACTTTTCGCATAGGGTCGACACCAGTGTCTGAGAAGATGGTCTGTTTGGAGAAACAATC
ACACGCAGCATTGAATTCGTAGGCTTTCCTCTGCTACCATTCGTGCAGCGTACCTGCCACGAAATAATGCCCAAGTGAGTAAGCATCATGCGGTAGTAGT
TGGTGAAACTCTCGGCCAGAAAACTCCATTTACCACGCAGGTCCCTAAACCAAATCTGTGGTGCTTCTGCTTGCAGTAATAATGACTTAGCCACAGTCCG
CAATATATAAGGAACAGGGAGTGCAGTACCATCGAGGTAGACGAGCGCGACAGTGCCGTATTTTGTCGATGTCTCGAGAAAAAATCCTGTGAGTTCCTTG
TGGTTGACCTAGAGCCAAAACCGTGTGAACTCAAACACGTCGCCAGAATACAATCCAAATCACACTCACCTTTCTCAAGTCGAGTCGATGCTGATCTACG
GGCCGGCATTGTGAGGGGAGATCCTTGATCGAGAACCGTTGCAATTCCTTAACAGGCTTCAGCAAGAAATGACCAACCAAGGTGGAGTGGTCTGAATGAT
GCAATCAAAACAAAACAAAACAAGCTGGTGTTCACAACGCTGCACTGCAACTACCCTTCTGCGAGATATCCTACCGCGAAATGGAGCAAACCATTTTACC
GACAACCCGTTTGCGATCGAATAGAACCGCTTCAAGTCGTCTGGAAGTAGATACGGGGAGTTTTTCTGGAGCAACGCATCAACGTCAGCATGAATATCTT
TTTCTGTTCTGGCCTCCCTTCAAGGTGTACACCTGCTCCCAGAGTCCAAGTTCCACCTGGGTAGCCCCAACAAACGGCTTCGACTCGACGCGCGACACGC
GCTCATGAGCTTGCAAGTACGAAAACACTCCGAGGGAAATGGCGTCCAAATGCTGCATTGGTGCTGCCGAAGAATGAACGAGCGCTCAGATTCTAAGATA
AGAGCTGCACGGGAACAGGCGGAGCCGGCGTTGCAATCCTCTAGCAATATTACGACGGAATAGCAGCTATTACAACGATCCCCTGAAAGTGCGACGAGGC
TCGACTACATGATTGAGCACTGCTCTTGGCCTGGGCCGCCACCAACTAACCACAAAATCAGCAAGAAGCAATCAAGAATTAGACTCTCTCCTGGACAAAG
TATCAAAAGTTGGACTTACGTGGCATGCCAGGCATTCCAGCCATACCGGGGAACATGCCAGCGCCCTGCAGAACCCGGACATAACACAGTTAGACCCTGT
ACGTAGTTTCTGCTCCAACGTTGTAAAGTAGAACGAACCATATTCGGCATAATCGGCATCCCTTCGTCATCAAACTGCAAGCCTGTGCACCGAGTTGAAT
AAAGTAGAAGTAAGACGCTTCTTTTCAAAAACAACAACATTGACTGAGGCGTACCTGGGGCAAGGTCCTTCACGATCTCCGAAGGCGGTTGGCCGGTCTC
CTGCATCTCCTGCATAAGCTCTGACAGTCGAGCGTAATTATCCGGCTCTGACTCGTACGCTGCGACGATCTGCTGGAAGTACTGGTACTGCTTGCCATAT
CTGCGCAAAAAAATAAACAGCTCACATTCAGGAAGGCAGTCGACAGAAAGCACACACGGATACACAAATGCCTACCGCTCGTAGTCTTCTTTAGACAACA
GCGACTCCTTCTCAGCTAGCCACTCAGGATACTACGCAAAAACGCAAAAAAACAACAACTCGTGATTAGCCTCCATCAAGCAGCAAAGTCATACCCCTTT
CAGTACTTGCGTACCCGCTCGCAGATCTGCTTCATGGGATCATACATAACGTCCTTTGATAGCAGTTGCTGCATCATGCCGTCCACCAAGTCCTGGAAAT
CGCTCTGCCCCCAAAAATCACCGTCAATAACCAGACACAGGAAGTCACTCAACTCCTGTAGCCACCGCACCTTTTCGCCCATCTCTTCAAACTTCTTCAT
CATCTCCGACATCATATCCTCGCCCATAGCTTCCACCTGGGCCGTACCGACGCCCTCCATGTCTTCCGCCGCCTTGGCCATATTCTGCAGCGTTTTGGCC
ACGCCAGCGTTCACATCGTCCGTCTCATCGGGCGTCGCGTCCACCTTCAACGAGCCCAGCAGCTGCTCGATGTTCTCGGCGTCGTCTGCATTCACCACAA
GAGCATCAGAACCTCTCCATCAATCTCTTCACTTGACTCCACTATACCGTCCGTGCCCAGCTCTCGAAATGCCTGCTCCAGCACCTGCTGGAACTCGGGA
TTCTGCGCGTCCTCGAGGAACTTAGCCATGTTCTGCCCCCATAACCACAGCGTCAGCGCTTCACTTCGCCTCGATCAAGTTCTTAACAGTTTTGATAACC
TCTTGCAGTTTGTTGTCTTCGCTGTCCCGCGTCGCAGCAGCGGTGGCGGCCGCTTCCTGCTGCACGGTGGCCATCTCCGAGGCTTGGGCGGTGCTCACCT
CGTCCGCAAAGTCGTCCAGCGCATCTGCAGAGACGGACAGTGAGCGGGTGTGTGTGTAGGTGAAGGAGGCATGGGTGGTTACCTTCGAGGAGATCGTCCA
GATCCACTTCCTCCTGCGTCTTGGGCTCGCTCTCCTCCTTCGTGCTCATCGTCAGGCTCCGGTTGACGT