Description :
From Genome Similarity Track
Location :
Scaffold_1619:233- 1899
Sequence
1666 bases(100 bases per row)
ATAATTGTTGTCAGGTCCTATCTGTCTCATGTTTTCACTACCCGTTGGTGCTGCCGTGGAGAAGAGGCTGTGGTCCTTTATTCTTCCTCTGTGCGTGCGT
GAGCAGCAATACTAATCTGAAGTAGAAGTTGAGATCTATGGTTTTATATTACAAAGCTCAAGTTGAAAACAACTTGGCAGCATGTTACTGTAGGGGATTG
ATTTATGTTCCGCCACATTTCTAAAGATTGGGCATGTTGATCATTGAGACGAGATGAGCTGATCTCAAACACCAGAAAAAACGCACCCTCCCTGTTATCA
TAGAAACGTAAGCCTAGGTGGTCGCGGTGAGCTTGTGTTCACAGATGAGATCGACTGAGAGATACTATTATGTTTCCGTCGCAGACACAACTATGTGACC
GCGTTTCATAAAAGAGCATGAGGGGCGAATGGCACGGCCTCCCAGAACAGCTCATCTCTACTCTACGTACTACATTCCACAGTGTTGCCTTTCCACGCAC
TGGTACCGCTCACAGTGCTCATCACCTGACTCTAGCGAAAGGCCTCGGATGACACCAGAATTCAATGTTGTGAATGCGCGTACCTCAAGGCCTCGGGTGC
CCCCAGTCGCACCCAGCCTGGTCGCTCCATATGCCCCTGATACGCTCCAGGGAGTCCCAATAGGCTTTTATATTCTTTTCCTAACTCAAATAGTCTCACT
TCACATTTTACCAGCTACACATCAGTTGCCAAGAGCCCCTCTGCCAACCAAGAGCTTGTCATTTTGGAAATGTCCATGAGTACAGCGGTTTTGTAGTACT
GGAAGTAGGGCACTCCTGCACGAATACCTACGGCTACTGGCTGTTGACAAGCGACAGCTTCAAGCTCGTGTGGTTCGGGAAAGTACCCCCTGCATAGAAC
TTCGCACCGAGCTTCGGGTTGTTGCGCTTGAAGCTAGGGTCTTCGTATCGCTTACAATTACGCCGGCTCCTGAGATCCACAAGTATGACGCTTCCATACA
CAGTGAACCTCCACTCAAATGCGTGATCTAGTCCGATACCTCGGGGTGCGACCATCCCCCACAAGATCCTTTAGTCGTTCAGCAACTGATCACATCTTGC
TCGGACAGCTCATAAACCACGCCCTTGGCTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGACTCAAGTGAGACCGTGGTAGCGAGGGCT
GCGCACACTCCACACTGACCCTGGTCCTTGATGCGCGTCACACAGCCCTTCGTTTGCCAGTCCGTGTCGACGATTCATGCAACAGCTTGAACTTCATCCG
CTAGCGTATGCCCTTGCGTAGGATTGGACGATTCCGATAAGCTCGATTCTACGAGATCGCGAAATTTGGTACTGTGTTGCCCTGGGCCGCGATCTGCTGC
TCGGCGAGCTTGCGAGTGCATAGCACTATACCGTGCGTTGTTCTGTTAGGAGACAATAGGGAGAGCCACACAGAATTGTGAGATCCTGTCAAGCAGTGAG
CCTTAGGCATGGGTCCTCCACTACTTTACTAGGATTCTTTCGTCCTACTTTCTCTACCAAATGGTCACTGTTCTGCAGAATCACAGGTTGTCGGCTGAAA
CCAGCAATGGATACGACGCACTTCGGTTGCGCAACTCACGTGAAACTTGCCATCATTATCAAGCAA