Description :
From Genome Similarity Track
Location :
Scaffold_249:233- 1765
Transcript NameFunction/comments
Phyin_T30-4PITG_21046Glycoside hydrolase%2C putative

Sequence
1532 bases(100 bases per row)
ATTTGGTTACTGGAGTGGCTGATGCTGTTCGTGTTGCCCTGCAAGAAACGTCTCTCGATATGAACATGTCACCTAACTTACCTGCATTCGGTGACACTAT
CGAGTCGCTAGTCGAGCAAGGACTCATTTCAGAGAGCCGTCTTGACGAATCTGTGCGGCGCATCTTGGAAACCAAACGGGATCTCGGACTGCTCGAGCCA
GACTATTACGATAGCTTTGGGCGTGACGGAATGGATAGTGCGTCTACCGTTGGCGATGCTGCTGATCAACAGGCCGCGTTATCGTTGGCCCAGGAGTCAG
TAATTTTACTGGAGAACCACAACAGCGCTCTGCCTATTGACCTGACAGAAACGACAAATATTTTTGTCACCGGACCTGTGTCGGACAACAAGGGCTTTCA
ATGTGGTGGATGGTCCGTGTTCTGGCAGGGATCCAGTGACTCGACGCTTTTCCCGAATGGTGCTACCTTCAAGAAAGCCGTTCAGGCCAAGGCAGCGTCC
TCGGGCGGGCAATCGAAGCTACATCATCTCGAGGTGGTTGATATTGATGGCAATGTGAACCCTCAGGACTTTCAACGAGGAATGCAGCTTGCCGCCAAAA
GCGAGTACACCCTGGTTGTATTGGGTGAGCCAAACTATGCGGAGAAGACTGGCGACTTGCTAGGAAGTATGGCTTTACCTGCTGGACAGTTGTGGTACCT
TGAGGAGCTTACAAAGCTGAATTCGACCAAGGTGATTGTCGTGCTGGTTTCTGGTCGTCCTCGTTTGCTCGAGGGGGCCCACAACCATGCTGACGCTGTT
ATCCTGAGCATGCTGCCATGCGAGCAGGGTGGCCAGGCACTGGCGGACGTGATTTTTGGGGTTGTGAATCCGTCAGCGCGATTGCCTATTACCTACCCAG
CGCGAAGTACCCAGTTATAACCGTATTTTCACCGTGTCAACACGCGATGTCAACCGTTCGACGAGTGTCCTGTGCAGTGGCAATTTGGTCACGGACTCAG
CTACTCGAAATTCGAGTACTCGACATTACGACTTAATGCCACTCAGGTTCACGCTACAACGGGAGCGCTGAAAGTAGCAGTCACCGTGACGAATCGCGGT
ACTCGCTCGGGCAAGGAGGTCGTGCTGCTGTTTGTATCCCAGAAGTTCCGACGCGTATCTGTGCCCGAAACGAAGCTACTCAAGGCATTCGAGAAACTGG
ACGAGCTGGCACCGGGGGCCAGCCAAGATGTCGAATTCGTACTCACACCTGAGGATTGGAGCTATTACGAGCCGCACATGGTGGGTCATGGCTTTCAGTG
GCGAGCTGAGCCCGGTGAGTTTGTTGTCTCTATGCTACCCTCTTCAACGGACACCTCGACAATGGCAGCACCACGTTCACTGGACGACAGTGATGAAAGG
AGCAGCCAGATGAAAACCCGTGGCGGCCCGGGCTTCTTGACATCAAACACTTCGGAATGGCCAAGTTTAGCGTCAGAGGCTGCCTCGCGTAGGGCCTCGG
GACTGAGCGCTTCATTCCATGTGATTCCCTAG