Description :
From Genome Similarity Track
Location :
Scaffold_938:233- 1697
Transcript NameFunction/comments
Phyke_g11753hypothetical protein
Phyke_g11754hypothetical protein PHYSODRAFT_426370

Sequence
1464 bases(100 bases per row)
GTTNTAAGGGTTTCCATCACTCGCGTGCTCACGTTATACTGTGATGTTTGCAGACCTGAACAAGAGTAAAAGAGTGCAGTTGCAACCGCCCGAATCTTcg
tctgtgtgtgtgaatCGAACATTTCCAGCGAAGAAGCGACACCGTTTTAGCGGAAGCATGGCTGCTTAAGACCTTCGAAACTTGGTAGTCCTCACTCGGA
ATGGTGAAGACATACGCGAAGACCTTGTTCGCTGCTGTCATATTCCAAGCACCACGATCAAAAACCCACTGGGCGCTGAGACCTGCGCTGTTGGCGTGCT
GCGCGCCGCCACAGTGAAAAGAGTGTGACGTGAGACGCTCGGTCACCCCAGCCTTCTTCGCAGTCCGCTCAAGAACACAATTGACGTAGCTGCGGACACC
ACTTGTGGTCATTGGGGCCTTGGCAGTCGAAGTGTCGGGCGTAGATTGTGCCAGTGACATTGTTTCTGGATGATCTAGCAGGTCAATTAGCGGGAAGGAT
GGCGGGTGTAAGCAACTGTTGATCCGGAAGATGGCTCAGTAGAGCAGGCGTCGGTGACGACTGGGTGACCAATGCGAGCGCAAAAGCAAGTATCGGACAG
GTTGCGAAGTCGTCATCAGGGAGAAGAGAGAGTCCTTGCTCTTCGACCGTCTTGATCTGGATGAATCTTACAAAGAAGATGTCGCCTGAGCCGATGAATA
GGTTGGACTTGCGAAGCAGCGTTAAATCTGACGCTCGGCCAAAAAGGAACCAAAGCAGGCATAGTGGTGCCGCATCTTGATAATCAGNTTTGCTTGAGTG
CCTTCTTCGTATATGCTGGAGCTTTATTGACAAAGCCTCCAGACTCGCGCTTCAAGTAGTACCGCTCTAGTGTCCGGCCCTTCTTGAGCAGACGTGCATC
GACAGCGGCATGATGCTGCGGGAACTGACTCAGGAGCCAGTCCTTCGCCTGGCGGAAGCACTACATGACCGAGTGACGCACTAGCAGCTTCCCCTTACGT
CCCTCCTTGAACGCCAGATGCATGCCAAACTTGTCCACTACCGCTTCCAAGATAAGTGCAGCATTTTCACGCAGCATACACGTCTTTAGATACTCCCAGC
tcacttcttcttcttctaagAACTTCATGAAAGAGCGCGCCGCGCTGTCACGAGCACGCTTCGTGTTGACAGGAGCAAGGTCGTTGAGGCTCATCTTACG
GATAGGAGGATTGTCAGTAGTTGTGATTTATGCGCGAAATATGCGAATGACTGCTATTCTGTATAGACATCAATAACTTTGCCGTGTCTCCGACCCAATA
TGTCGGAGGGGTGGACATGTATTTGACCCTCtttgtgattggctgaaacgCAGTATAATTGCTTTCTGATTCGCTAAAAATCAAATCAGCACTTCTTATT
GGCTAAACCTCACAATAGTGGATTTAAGTAAGGTCGGAGAAGTGATGATATTCACCCATACCAT