Description :
From Genome Similarity Track
Location :
Scaffold_854:233- 1650
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_854-fgenesh-gene-0.0Conserved gene of unknown function

Sequence
1417 bases(100 bases per row)
CcGAcAAtGcTCGcTACTGGTGtGaTCgAaGgCACCGTCGACGACATcGTGTTCGCCATGCACGAAGCcTCAGCcGATGAGACCAAGGCCAGTGCGGCTg
TcgTTGGGGACGAcTCCCTCATtGACACGGTCGTGCTCCACACCATCAAGGCATCCAAgaCGAcTTATCTCGGgCTCAAGTGGAAGCTCAGTCGAACGCC
AGGCGGCAACCGGGACATGTGCTTTATTGAaTATGTCGGTGTGGCCAATGATGCCAAGGGCCAGCGCTACGGCTTCAAGGTGCTCGAaTCCATTAAACTC
CGCCACTGTCCGGCATTCGCCGACAACTCGATCATCCGCACCGACATCTCGTTCTGTTATTTATTCCGGGAGAGCGGCACACCCGGCATCGTGGATGTGT
ACATGCAAGGCGCCTTCGACTCGTCTGGAGACGCCGTGACGGCAGGCGGTGTGGGCGACTCGCGGTCGACGATCGACATGCTGCTTGAAGTGGAGCGTTG
TATGGAGATtGCAGAGTCCAAGAAGCTCTTGGATCTCGTGGCgAaGCAGGCAGCAGCCCCGCcACGGCCcAAGCAGAACGGCTCCCAGTGTTCGATCTGC
CGAGCCAAGCCCGGATTACTGTCGTCGCACTTGCTGTGCCAGGGCTGTGGGGCTGTGATCTGCACCAAGTGCCGCATGAAGAAGGTCGTGGTATCGTTCA
AGAAGGGCTCGCCcAACAAGCAGAAGGTctCCTGCTGTAAGATCTGCCTGGTCAACGTGAAGGAGAAGTCGCCGTTCGAAGGAGAACAGATCCCcAcGGC
GCAGCCAACGCTCAAGGCGATCCaGaagaaGCCGTCGGCCAGTGGGATGACGACGCCGTCGTCTGCGAGCTCTCGCTCTGCATCGATTGATCACCACACG
GGTGGCGGTCTCGCCACAACTCACGAGCTCGCCCTCGCTCTTCCTCAaTCATCAGGAGCTGTCGCCAAGTACGACCGCCACCGTACGGCCGACTCACTCA
CGGATACCGACTACTCGGCGTCCATGCAGTCGTGGCAGGGtAGCTCCGTGTCGTCCTCATACTCGGACCTGGACGACTCGTACGGCgCGTACTCTCCTCA
CAACCAGCAAATCGTCGCGGCCAATGGCAAGATGCCAGTTGTGGCCGAGTCCCCAGCCGCAAGAGCCCGTTACCACGCGCAACTGCAGCAGCATGCATAC
CAGACGCCTCCAGGAAGCGGACGAGGGTACCAGACTGGCCCACCGCCGCCGGGTGGtGGTGCGAACCTGGACCagCATCGCCTCGGTCTCTACAATCAAA
TGCTCGAGCTGCAGATGCAGGCAGAGCGGGCGTACAACCTCGCGAATCAGAACGCCGCGTACATTCAGCCACAAAGGCAGCACGAGTAGAGCCATtCAGT
CAGTCAGTTAGGAAAAC