Description :
From Genome Similarity Track
Location :
Scaffold_1034:233- 1431
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1034-snap-gene-0.4Conserved hypothetical protein

Sequence
1198 bases(100 bases per row)
GGAGAACGTTTCGCTGCAAGTCGCTGGCCACGGGTGGATCGTCTACTACGACGGACATGGCACGATGTACTTGCTGAAGGCTGAGGATGCCGACGAGCTC
GACACAACGTGGAACTGCGAGTATGAGTGCGCTCCGCTTGGGGTGGTTCCGTCGCTAGTACTGGCCGCATCACTTGACGACGAAAAGCAGCGATGCTACC
TGCTCGCAGCCGAGCCATTGAGCACAGCAACAGACAGTGACGCCACGTTTCGGCTGTCATCGGTCGAAGTCTTCACGGTAACTTCAAACTCGAGCGACCT
CATGGATGTTGATGGCGACGCCGTGGGATGGACGCACTCGGCCACTGAGGTCGCGCTTGTTGCATCTCTTCCGAGCTACGTATCGCTGATCAAGAACCAT
TTGATCGTGCTGCTCGAAGGCACGTACTCGCTCTCGGTGGAGACCAACGCAGTCGTGTCGGTAGTGGAAGCCGAACCGACATCGAACAGCAAGGGGAGCA
GTGCAGCCTCACCACGCAAGCGACCGCACGGCGATGACGATCTGGACGACGACGAGATGCGCGAGCTGCTGGCCAAGCTCCCGCGCGCGGGCATTGGCTT
CCACGGGGACATCAAGGACGTCAAGGACTCGAGCGATCTGGCGTCACTCGACTTCAACACTCCGCTGGCGTCGCGGTTCCACAAGTCAAGCACGCCGTTC
AGCTCTGTATCGGATGAGCCGATGGTGAGTGCGTCGCCGGCTGGAGCCCACGCTAGTACGAGTCCTCGGGAGCGACCGCTGGAGATCCCGACGGCCGAGT
CGATCCTTGGCGGCTTCGAGGAGTGCGACGACCGCGACCCACTCGCCAAGGCCGCGCTGGTGCAACTGGATCTCTCCGAGAAAGTGGCGCGCGAGCAAGT
CGAGATCGACTGCAAAGAGTATCGCTTCCTGTGTCCGAGCGCAGGCAACGCCAGCTCTTCGCGGCCCAGGCTGCTGTTCCGCAACGACGTCCACGGACTG
GTGTACGACCTCGAGGTGGCGGCGAGCGGCGCGCTGACGCTTCGGCACTCGGCGACGCTGCCAGCGTTCGGGTTCGTGCAGGCGTCCAAGCAGGAGAAGA
AGTTCCTCGCGGTGGATCCCGCCGCGACGTTCGCGTGCATTGGCGAGTTCGAGAAGCGCGTGTTCGTCTACTCCGGCGCGGCGACGGAGCAGGAGCGG