Description :
From Genome Similarity Track
Location :
Scaffold_66:232993- 242080
Transcript NameFunction/comments
Hyaar_Emoy2807618hypothetical protein
Hyaar_Emoy2807619polyketide synthase

Sequence
9087 bases(100 bases per row)
ACGTCTGTGGACGCGAAGAGCTCTTTCTACGCTCGACGTCAGAGCTCGCGTCACTCATGAAGAAACTTGGACGCACCCAAGGCCGCGCGTACTTTCGCTA
CGTACTGCGCAACGTGTTTGGTGACAAGTCGCAGTTGTACGAGATGCACGGACCGCCTTCGAGCAAACAGGTGGCTGAGTACACCAAGAGCATCATTCAG
CGCTTGGCCAAGGCGATTCACTTTGCACCGCTCGTTCTGCGTGCCGGCTGTCACTACATGCTCATGGAGTTTCGCAAAGCGTTTCCCGAGTGCAAACACG
ACGCTCGCATTGTCGTGGGGAATCTGCTGTTTCTGCGGATCCTCTGTCCCGCCCTCGTGAAGCCCGAGATGTTTGACTTTCCTCCTCACACGACCCGGAC
GCTGCCTATGGGCGTGCAGATTGCCAAGGTCCTGCAGCACACTCTTAGTGGAACGCCGATAGGTGACAGCGACCCGACGGTCGACGACAGCAACGCCTTT
ATCCGGACCTTCCAACCGTATGTGGCTAACTTTCTCGTGCGGTTCCCTCAGATCCGCGCGGCGTTTGGAAGTGAAGACTTGCAGCAGCTGCTTGAGGTAT
CGCGGGCACCGGCATCTTGGACTTGTAGCAACGGGTCACCAAGTTTGCCTGCAACGCCTTCACGGAGAGAGAATTGGCCGCTGTCGCCCCATGCCGAGTC
TTGGAACGCCCGACGCCCAAACGGTAAAATGTGTGGACTCTCAATGAGTGCGAATGGAGTGACCAAGAGCAAGAAGAAGTTCTCGCTGCGCTTTTGGTCG
AGAGGCCACGACGACATGGCACATCGACAGTCGCCCTAGGTTTTTTGCAATACTCATGGACATAACTTTATTATTTAATCCACGTGCACGGAGACATCCT
CACATAAACACGATGCAGTTTTAGTCGAGGCTTTGATTCTTGTCGGAAAAAGATGTAGCCATGTGCACTGCACTACTGACGACTCTCACTCACCCGCAAA
ACACATGGCACTGAAAAGATGATTCAGGACGTTGCACCGAACTTTCCGAGAACTCTACAACCTTCAGAACATGATTTTTAGCAAGACTGAATAGTCTGAC
CCTATATGTTACAGTAGCTTTCATTCCCGTATACCTTCAGTACATAATAATATTGTCTTATCGTATTACAGTCCTTTCTGCTTTAAAAAAAGACTAATTA
GTCTTGCTGAATGACTCGCGTATAGCTGCGAATGGACAACACGAGCACAACCACCTGTGTAGGCCTTGAGCTCACGTGCGCGCGAAGTACACGCCTTGCC
AGCGACCGCGTTTATGTAGGAACTGCAGACGGAAGGGTATGTGCAATTGCCGCACCTTCGGTGCAGGATCCACGCCATCATGACGAAGCCGGGCTACCGC
TCACGCGCGTGTACTGGTCCTTGCGTTTGTGTATACACGCCATCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTATCATTTTGTTAAGCTAGA
TCAGGAGTGAATATTGTTGATGTGGTTGTAATTTTTGTGTAGAATGTGTGTGGCGTGGACGCGGATGTGAACTATACACACACGCTGCTGGTCGGTAGTG
CTGGTGGAGAGCTCGTGGTGCTGCGTGAAGAGTTGGTGGGTTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTATCATTTTTTTAA
GTTAGATCAGAGGTGAATGTGTTAGAGTGGTTGTAATTTTTGTGAAGAAGGTGTGTGGCGTGGAAGCGGATTTGAACTAATACCACACGCTGCTGGTCGG
TAGTGCTGGTGGAGAGCTCGTGGTGCTGCGTGAAGAGTTGGTGGGTTCGACCGATGAAATGAGTTGGACAGATGAAATGTTTTTGGGCACCAGCAACTTG
ATTAGGGACGAGCAGATTGCTGACTTTTGAGGGCTTTTGATGTGAGTAGGAAGTTCGACGTTTTCAGCTGGAAGGCGGCGTGCATGACATTTGCTATACT
GGGAGTGGCGCGTTCATTGTCGGCGATGCGCTGGGCAACTTGTACTGTGTAACGCAGTACGAGGTTCTATGGAAGGTGTGTGCAATGCGGAGCAAGTGGT
AAATGGAGGGTGATGGTTCTTTTGGTTATTGAAAAGTGCTTTTGCGCTTGTGCTGCTGTTGATAGCGACGGCTCTCAGCTATTGCGGATGCTGGAGACGA
CACCGGTTTAGAGTTTTTCTACCCAGCTGCGACGCAGCCCATAGTGCATGCGATCGCGCGAGTCAGGCTGCTGGACGTGGAACACACGCTATCAAACTAC
GTTTTGGTGGCAAGTGGCCAAAAGCATGTAGTGGCGACGTGTTGTGGTAAAACGCTTGCTGCGATCCCGACCCGTACGCCAATGAAAACGCTGGCTGTTT
TCGAGGGTGTAGACGAAGACATTGTATTGGCTGCCGGCGAGGAAGGGTACGCAGCATTTTTACTTGCTTTGATACTGACATGATCGAGTTGAGATGACAT
GTGACGATCTTGTTGCAGAATAATCTATCGGCTTGTAAGCAATCGAGATGTAGTGTCGAAGGAGATGTCTGACTTTCGATTTGCAATGGAAGTGTGGGTC
AAGACATCCGTTTCCGTTGTGAAGCTATTGTCGGTGCAGACTTCCTCCAAAGTGAAAGTGTCTGAAATAGCGTGGCTCTGTTTGGGTTCGGATGGCGAAG
TTGCTCTCTTCCGTGGTCAAGAGTGTGTAAAAACGTGGGAAGCAGCATCGTTTTCTAGTGTCCTGAGTGCCGGCTTGGATTTCCCCGTCGACGTGACACT
GCTAGCAAGTGACGATGTCAGTAGTTTGCAACTACGTGGAGCTATCGCGTTTCGAGACCGAATGCGCACATTCCCGATCGACCTCACGGGTCAGCGGTAG
TCGCTGGATAGTGCGGCTGATCAGTGTTAGCGTGCAACTGTAGTGCAAATAATGAAAGATACACCCTAGCTTCTTGTTACTTACAAACTTTACACACAAG
TGTAGTTACCGTGCTACCGGTGGTCGCAGGAATAGCACCAAGTTTTTTCCATCGAAAGGCAGGAATGTTTTTTCAATCTTCGGATGTTTTGCAACGAGGT
ACTCAATCAAGTCATCGAACGACAGCACCTTGCTTCCATCTACGAGTCGGCGATCGGGAAACTTTTGGCCGAACACACAGCAGGGGACTACCGCAAAGGG
CTTGTTGAATTGGACGGCAACGTCAATGATCGATTCGGTGGCTTCGTCGGGGTGCACACCAAGAAGAAGTGACGCTTGATTAATCAGCTCAACGTGTTCT
GGTTTCTTCAGAAACGTGTCCATGTTGAAAAGAGCCGTCACTTGCGGAACAAGAGATTCGGTAAGAAGCGTTTTGGCTTCGCCAATCTGCGATCGTGCCT
TCTTCTGCTTCTTCAAGTATTTATGCTGTTGCTTCGACAGTTTTATCGGACGCTGAGCATTGAGCAATTTCATGTAAGTCCTATTCAGAAAAATTACACG
AGCAAGGACAAGCACTTACTGGTTCGATCAGTGTACAAGGCAGTCTCCGCTTATTCCATAGCTCGAAAGACACATTGCCTCTTCCTCCCGCAATATCTAC
AACACCTTTTCCTCTAGCGAGAAACGGTGCACCAAACGTCCCAACTAGCCACTCAACAAAGACTTGCGCACGCTGCTGTTTTCCGATTTTTCCGTGAGGA
TCGAGAGGGTCTTGATCGATATGAGCTCGCACGCGTTTGAGGTACAGACGGTCGACTAGCCACTTGGTACGCTCCTCCTTTCGTTCAGTATTGCTGACAT
GAAAAAACTCACACTTGTCGCCAAGGTGACATGTGTTCGAGTTGATCCAGAACTTGCAGTGCACCCTTTTGTCTGCACTTCCGATCGTGGTATGCTCTCC
ACAAGTCGAGACCGCCTCGCTACCAGCATTGATTTCATTCTTTTCTCGATCGATAGACTGCTGTTTACTCGAATCAATGGCCACCGATGGCAGCGGAAGA
AACGACACTCCCGGATTCGCCTCTTTCCACGCACGAACAACAGTGATATCGCGCGCATGCACTAAAATCGATGACTTGTCTTTGAGTCGCTCAATGAATC
CCCGGACGCGAACAATGTCTCCAAGTTTAACCCGGTATCGAATAGCGTCCACCTCGTCCAAGGACAATTTGTAGTCAATGATCTTAAGAATCACCTCAAG
TCGCTCGCGCTGACCATCTGTTCCTAGTGTCATTGATGCCAAGTCATAGAAGGAACATTTACGGCTAATTCGACGGTGATGCATCAATTGGCCTTTCACT
ACCGTCGTGTCAGCAAGGAGAGATTGATCGTCCCATTGCGCTACTTCGTTGCAAAGGCGTGCAAAGCTCGACCATATGTGTCGCCCCATTTGTGCGCCAC
CAATTGCAATTCCGAAAACTCACTGGTCGATAGTTGTTGATGATCGTCGAAAGGGGTCTGGAGCAAGAGGTTGAGCGGCTCTGTTGGCCCAATGAATCTA
AGGACAAAAGCGGAATCAGTTCGCACGTAAAAAGACTAAAATGTATTTTAGGAACGTATACGGGATCCGCATGCTGCATGTGCGGAATGAGAGGTGCTGT
TGAAGAAGAAAGAGGTACTCCATGAAACGAGGATGATGCACGTTGAATTCGGTGCAACGGCTTTGTTGTATTGGGGTGCCTCCGTTACATGATATGTTTA
CATAAGGTAAATATCAAGTATGAATATTATGTTAAGGCAGACATCATATTCTCACATATTATATTAACAGGTAATATTGTGATGCAGAAGTAATACACTG
CTCATTGGTTGATATAGGAAACGATATCAACCAATAAAGCCGAGCCACGACAGACGAACGCAATGAGTGGTGAGCAGATAATTGCAATACATGTTTGTAT
TTAGGCATAGTCAAAAGAAGACTAAATTGGATTCATTGACAGGAGATTAACTACTAATTACAATTCTACTTTTACCCTTATCTCGTATTGAAACCTTCCT
TTGCACGATACGTGTACGTGAGATTCCAAGGCACCTACTTACCCTGTGTTCAGAGTAAGTAGCTTGTACTGTGACAGTACAAGCGATCGGTGCCCCGTTA
CATCTAGTAGCACTTTGTAGTCCAACGAATGTGAACATGTTGGATGATGAAGCGGAAGACTTCCATCCCACATATGAGAGCTACTCCCATCGAGTCAAAT
CGAATGGGATGCCGTGGAAGATTGAGTTCGGCGATAGGGCAAGAAGCCGTCGGCGCAATGCTGTCCGCTCTAGGTCCAGACGGACAACACGTCATGATCG
CCAAGTTCATCCAGAATGAACTTGACGCTGAACGGGAATAGTAGCCTTGCTTCACCACCAAGGCTCTCAACAGACAGAGCTGTTGAACCAGCAGCAGGCT
GCTGCTACCGGGTCGACACACACGTCGACTCGAGTCGCTGAAGATTGACATCTTCAAGTACAAAGGAGCTGACACAGACTCTCTGTTAAGATGGTTTGTT
GAACTGGATGACGCCATAAGGGCTCGTCACATCGTCGATGAGCAAATGCAGGTCGTATTTGCTCAATCGAGCCTGGCGGGACGTGCGAAGACTTGGGTCT
TGGGCCTTAAGTTGCACGGCCCATATGTCGTTGGGTCGTTAGAAGGCTTCAAATCCCGGCTCGGACAAACGTTTGAACCGCCGCGAGCTGAGTTCAGGGC
TCGCTCAGGACTCCTGAAACTCAAACAAGGGGAAAGTGGTATACACTCATACATTTAGTATATACGTCACCTTACGAGTTGCATTACAGCAAATCCGTTA
AATGAACAAGCGTTAATCACGTTGTTCATGGAAGGTCTCACGGACAGTCCAGTCAAGACCTACCTGTTTCCGACTGGAATTCGATACCCTGGAAGAGTCG
ATCCGGGTTGCGGAACAGGCAAATTTTTAGCGTGAAAATAAGCTCACGTGAATTCGAATTCCTATCGTCCTCCAAGGCGACAGGAAA