Description :
From Genome Similarity Track
Location :
contig_109:23299- 29419
Transcript NameFunction/comments
g11177.t1PREDICTED: uncharacterized protein LOC101063318, partial
g11178.t1hypothetical protein
g11179.t1hypothetical protein

Sequence
6120 bases(100 bases per row)
GAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACC
TCTCGAGTGCGACGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTGCCCGCGAGTGCACAGC
ACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTG
ATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCT
TGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGG
CTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTT
CTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGAT
CCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTG
GTGCATGCGGCCCTCCATAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAGAAGATGTGAAC
CGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGA
AAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAA
ATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAAT
ACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAA
GTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGT
ATTGGTCTCCAATACAAGAAGATGAGGCTGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGA
ACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCG
GACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGG
ATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACA
GTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCG
CCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTC
GAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATAT
CCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTC
ACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGC
ATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACT
TGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAG
TTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAAT
GGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGT
GTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCA
GCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGG
TCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCA
GGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTC
GTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACC
TTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGAC
AACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGA
AGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC
TGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAAC
AAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTC
TGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTAC
ACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGC
TACGCGCACTCGTTCCATCAATGGAGCGACTGGCTTGCCGATTGGCGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTAC
GTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATA
AGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGGGCGTAGACAC
TTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAG
CGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACGGCAGGGGAAACACAAATGA
ATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGG
CCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGT
ACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGAAGCCAGAGAGCTCGTCCCGACCTCGACCTTT
ACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAG
CCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGT
CCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGG
AATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTC
GCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACAC
ATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAAT
ACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGG
TTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATC
GGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCA
CGAGTACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGA
GGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGC
TTCGAGCTCGAAGCGTTCGGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGGTCCTTGTCTCCTTCGAGTTCCC
CCTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATCCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTT
CGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGGCATCGCCGTCGAGGCGATGCCAG
TAGCGGTCGTGGCTGAGGCA