Description :
From Genome Similarity Track
Location :
Scaffold_3:2329717- 2339982
Transcript NameFunction/comments
Phyin_T30-4PITG_02497HECT E3 ubiquitin ligase%2C putative
Phyin_T30-4PITG_02498Iron sulfur cluster assembly protein 1%2C mitochondrial
Phyin_T30-4PITG_02499Putative uncharacterized protein
Phyin_T30-4PITG_02500Putative uncharacterized protein
Phyin_T30-4PITG_02501Putative uncharacterized protein

Sequence
10265 bases(100 bases per row)
ACTAGCGGTGGGTGAGCACATGTGTCTGGCAATCTGAACAAACAACTGCAGTGATAAAACACAAGAGTAGATCGATGATTCCAACACCGAACTTACCATC
TCTACGACCTCAACAAGACACTCCGTGAGTTTAGCGAGATAAATCTTACACTCAGCATCGACGTTTGCTAACTCCACGGAAATGCGATGAATCTGAGGGA
TCGAGACTGGTTGGTCGCTAGTTACTCGCGGGGTGTACACTCCACCGGATTCCATTGGGTCTCGAGGTGTCGATGCCACAGAAGAGCAAGCAGAAGACGC
TGCTGACGATGCTTGCGATGACGGTTGATGTGCTGTAGACTGGTGCGTGGTTATTTTAGGGCAGCCGTCATGATCGGCACCTTCGTTAGTGTCGATGAGG
CGTAAAATGTGCGCTGTCTGCAGTGTAAATTGTGTAAGGATATTGTGTTGAGCTAGCACCGCCCACAGCACCGTATCATCTTCGGCTCTGTAAACTGTTC
CTTCGGGGGTTATACTTTGATGCCGAAGAGAGAGAAAGTTGCTACCCCACAACGATCGAGTCGCCTGCGTCCACTTCAAATACTTTCGAAGTGTCGGCAA
AAGCATCGACAAGAGCATCACAAATGGACACGAGCTGTTTTGCCGAGAGCGCGGGTCTAGAGCCTGGGCTAAGTCATCAAGAGCTCGAAGTATTTGCCTT
CCAGTATGGGATACGATTTCTTCTGTGTAACCTTCGCCGCCCACGTGACTTAGATGCTGGTGCAGTTCTCCATACAATTGGGCACTCGAGCGGAAGAATG
AGAGATCAACAGTGTGGCCCGCTAAACCTTGACGAGAAGCTCCAGCAGGATGATCTGATTGTTGAGTAGACTGGAAAACGTCTTCGGGCTTCTTTCCAGA
TTTCTTCTTCCCTCGCTTCGCCATGATCACAACGCTTACTTACCAAAGTAAGGCACTGCTACGACTGCTTACAATAATAGCTTCCTCGACACTTGACTTC
TGTAACGTGCCATCAATGCTGGTTTGGTATCCCCAGCCACTTCCTCCATATTTCAAAGGGCGGACTAGCCGTTGTCGATAGTATCCAAGCGGTTCAGCGT
GTGATCGGAAAACGCACTGCGAGAGGAACGCTCGTCAGATACGACCGTCGAAAAGTTACGTCCGATGCAACATCGTAATACGAGGATCGTATTAACGCTT
TACCACAACGCCAACGTCCCTTCAGGCTTTCCAAGTCGCCACCTTGCACACAATTTCTTGCGGGGCACCTGGCCAACAATCGGCAACACGCAACAATACG
TTGCTCCGTGCCGCATGGACCGTGCGTTTCACGAGCCTCGATATGCCTGCCGCCACCCACCCGTTCCTCCAAGCATGCAACTTTACGCCCTCCACCAGCG
TAACATTTTTATCTGATTTCCAAACTGTGGTTTTCGATGTAACGATGTGGGACCTTAATCGAAAGCCGCATTCAGTTTCAAGTGACTCACTTGATCCGGT
CTTGGTGATCCTAACACTGTGCACTTCAAAGGATTTCCGGCAGACCCACACGTCTAGCATTTCATCCGCAGTTGCTTTTCCATCCCGCAACTTTTATTGT
CACCTGCCCATTGGATGAAAAAAACGGCCACTTGAAATTTTGCAATCCAACGTCAGTGCAATTCAGCAACTTCGGGCACAAGTGAATTTGCCAGTAATAG
TGTCGTTTGGGGCAAGTGTGTATCCAGGTAGATAGGTTCATCTCATTTCGTTCCCCCCTCTCACCACTGATAGCGCAGTCACTGCTCAAGACACACCCGG
AGGACAAGAAGCTTGCTGCTGAATGAGCGACTCCTCGTCCCTGGGCGGTGCGCTGATCGCCGCGGGTGCGTGCGTGCTGCTGCTGTTCTGTGTGATCGTG
ATGTGCGCCAGCTACTGCCACGGCCTGGACGACAACGTGGCTATCGACTCGGTGGATCTGCGCAGCTTACAGCTCCGTGAGGACCTGGTGGACACGGTAC
TAGACGCAGGGCGCAGCGAGTGGCAGTGTCTGGTCTGTGCTCATATGAACCATCCGAATCATGAACTGTGTCTGCTGTGTGGCACGTCGGCTGAGTTCTC
CACAATGGAGGAGACAGTGGAAGACCCGAATACAAACATTAAGACACGTCGCGTGGCTCGTACTACCTTCCTAGGCACCGACAATAACACATTACTGAGT
TCTACACTGCTCGAGAACTTAATCACGAGCTCAGACTCGAATCCAGTGATGATGGGAGAGACAGAGAGCACGAAACCTTCAGCCACGCTACAGAAAGCCA
AGACATTGCCCATGTTACGCAGTGGATCCTCGTTCGGAGACACAGCGCAGGAAGTAGAGGCCACTACGAGCATGAGACAGCGAGCTTTGCGCTACAGAAG
ACTGAACGAGATGCAACTGAACCAGAAACAAAGAGGCGCAAGCAGAAGAAGACTGTGGCAACGTGTGCCACTCCCCAATGGAGGCTTCGTATGGGTCAGA
ACGATGGAACCCGCCGATGCTGGCTCGGTATTCGCACGAGCTGATTCGTTCGTGCATAAACTACGGACCAACTCGTTTCTATCGAAAAACCCACAGGCCA
AGAATTTGCGTGGAGATTTAGCAGAGCAATTGCATCGGAAAAACGCAGCGTCGATGGGATTTTTCACAGAACTCAACGCGTCCGGTACAGCTGTGGCATG
GAGGAAAACGGACTCAGTTGCGTTGGATGTGGACCCGAAAGGTGGAGACGGAGAACCTTTGGTGGACTTTGAAGGCGTGCTGGCCATGACGTGGAGAGAG
AAGAAACGCTGGTTTCTCAAACAGATCACTAGCCTCGCAGTGCCGTATACTGAGTCCATGTTTAAAATCGACGTGCGTCGTAGTGCCATTTTGGACGATT
CATTGCCACAATTGGCAGGAGAGGACGTCGACAAGTCGAGGATGCAGGAACACTTGAACATTGGCTTTATTGGCGAGCCAGCGTTGGATGCTGGCGGTGT
TTTGCGTGAGTGGTTCGGACTTGTGTGCAAGGAGCTTTTCAGTGGCCAACGTGGTCTGTTTGTGACGACACATGCAGAGGATTCGAGCTATTGGATCAAT
TCCGAGTCAGTTAAGTGCGTGCCGGAAGGACAGGACCATCTGCAGTATTATACGTTCGCTGGGAGGCTTCTAGGGAAGGCTATTCTGGATGGTTTGGTGC
TGGAAGTCAGCATGTCGTTGCCTTTATTGAAGCATTTGTTGGGCGTCCCGATTACTTTTTCGGACTTGGAATTTCTGGACGAAGAGCTTTATAAACACTT
GTGCTGGGTACGAGATAATGACCATGTGGATGCTTTGTGTGTGACGTTTAGTATTCAAACCCCGTCGGGTGAAATGGTGGAGCTCAAGCCTGGGGGAGAG
GACATCGATGTGACAGACGAGAACAAGATGGAGTATTTATCTCTCGTGTTGCGATACCGTATGCTGGACAGTGTGGCTGATCAACTCACTGCGCTACTTA
AGGGACTGTACGAGGTCATTCCGAAGTCTCTCCTTACTATCTTCGACTATCAGGAACTGGACTTTTATCTCAGTGGCTTGCCAACAATCAACGTGGCCGA
TTGGATGAACAACTCTCGCGTTCGACACTGTGCCCTCGACGACGATTCAAAAGGAATCGAGCAAGAACTTGAGGTGTTGCAGTGGTTCTGGGACGTCGTG
AGTTGTTTCACTGATGATCAGCGAGCTCGACTACTGCAGTTTGCAACAGGCTGTTCACGTGTACCTGTGGAGGGGTTCAGGGCGCTCACTAGTGCTAGTG
GTATTGTGCATCCATTTACGCTGCAGATGGTGCCTACTGGAACGCCTCCGCTGGGCATGTGTCCGCGTGCACACACTTGTTTTAATCGCATCGATTTGCC
TGTATATGAGACCAAGGAGGATCTCAACTCGTATCTATCACTGGTGCGCCGTCTTCTTTAAGTGGTTTGGTGTGTAGTTTGCTGACCTTTGTGTTGTGTT
GTTATCTGTTAGGTGATTCAAATGGAGATCACTGGCTTTGGCTTTGAGTAGTGTACTGTACATGTAGCTGCATCAAGATGCTACAGCGATGACAAACAAC
TAACATTAGGTGGTGAAATATGTAAATGAAATAATTTTGGTTTAGAGCGCGTTGCCGAAGTGCGGCAGCACTCACCAGCTTGGGCAGCAACACTTTTTAT
ACATGTACGTGTACTACCGTAGTATACGGGTCGACGATGGAGTTCTTCTGTTGACGCTCATTAAACATTCATTCCTGTTTGATAAACAGACGCTGCGTCA
TTAGCCGACGTCACTGATTGGACAAACACCTCTTTCCACCAATCACCACGCGTTATTTCAAAACCTATGTAATTAAATAGGATTAAATATCACAGTAAAC
GGGATTTGATTGGCCCGAGACACGTGCCCCCTCCCGAAATCTGTGTGGCTTACACGATTCCGCTCAGCCGTCGAGTGGTGGGTCACTCATTTCGCAACGG
AATCCAACACCCCTCGAAGCAAAACTATGATCGCTCGTACTGCTCTTAAGCGCTCTATGGGCGTGTTCTCCCGCCCGGCGGCTAATGTGACCGCTCCTGC
GTTCACACGGGCGCGTATGTACCACGATAACGTGATTGATCACTACGAAAACCCGCGCAACGTTGGCGCGATGGACAAGAGCGCCAAAGATGTCGGCACG
GGTCTTGTGGGCGCCCCTGCGTGTGGCGATGTGATGAAGCTGCAGATCCAAGTGGATGAGAACGGTACGATTGTGGACTCTAAGTTTAAGACGTTTGGCT
GCGGCTCGGCGATCGCGTCCTCGTCGGTGGCCACCGAGTGGCTCAAGGGAAAGAGCGTTGAGGAGTGTCTCCAGATCAAGAACACAGACATCGCGTCGCA
CCTGAAGTTGCCACCTGTCAAGCTGCACTGCAGCATGTTGGCAGAGGACGCCATCAAGGCTGCCATCTCGGACTACAAGCGCAAGCAGAGCGCTTCCGGA
TAAGATGACACAGTATAGCAACAGTCTTGTCGTCGCCGTGCTCCACCCAAATGGTCGTTGAGGCTCAAGATTTCAAGGATGGTCAGTAGTCGGCGCTCGG
TGTGGGCGTAGCTTGGCTAACACCGGAGAAGGCAGGTCAAAGAAAAGCAGACAGTATTGAAGGAGAGCGAAGAAGCTGTGAAATAATCAGTTGCTAATTT
ATTGATCTACACTTCATGTAGTTTCTTTGTGTGCTTTTGGTCTATGCTGTTGGTCTTGTTCGAAACTTGTCGCCCTCCGGATTAGCTTCCAGTGACTAGG
CATGTTTCAATCTCAGTGCACGAAAATTTGCATACACTAGTGACACTAGTCAGTTTAGATCAGTCGTGTATTCATTTATCCAACTTGCTCCATATAGCTA
AAATGTCTCGAATGGTGGCAGATTACCAAGGATGTAGCTCACAAAGTGAGTCTCATCTCAACCGCCACTTTGCTGTGACAAGCTCCGTTTCTGTTGCTAA
ATTTCCAGGAATTAGACCAAGAACCCGACGTTTTATCTTAATTCCTCGCTGGCCACCTACTAATACGCAAAACCCGGAGCATACAGCTCGAGCGTAATCC
CGTTTTTCCTTTGGCGAAGTCGAGACAACCAGACGCTTGCACTTACTCAGCTTGACCAGTTCCAGATTTCGATTGGGCATTGGAAGACTTCGACCTCGAC
ATTTGGAGGTAAAGCTCGCTCCAACGTTAACAGGCTACGAAAGGCGAATCCCTACCCGTATTCTTAGGTCCGTGCATCCAAACCACCACACCTGCGCAGC
CAAGAAACGCCCCGAAGTCCCGCAGACTCGTCGCGACAAGCCTAGAGGACCCACGACACATACACAACTCGCTATGGCTACTACCGAGTCGCTGCGCACC
GGCATGCGCTCCGTGTACCTGCCGCAACATATTGTCGTGCTCGTGCACGGTAACAACGGCTCGGCCGCCGACTTCGACGCCATGGAGGCCGCTTTGCTCA
CCAAGTATGGCAACCGGCAGCTACTCATCATTAAATCGAAAGCCAACGAGGAAGACACGTCGCTAGGTGTGGAAATTGGCGGCACGAGACTCGCCAAGGA
GGTCGTGGAGGCAGTTTTCGAGTACGACCTGAGTCCTGCCGTAAACAGCTACAAGTTGTCGGTCATTGGACATTCATTAGGCGGACTGTATGCGAGATAC
GCGATCGTCCAGATCATGGACGCGCTGAGCTGTCTACACGTGGAATACGTCGACTTCGTCACCATTTGCACGCCCCATTTAGGCTCCAGGAGGGCTAGAG
GACCGTCCACCATGAAGGTTGGTGTCTTGTTGATGCATTGGTGCGATGAAGAGATCGACTCACCGCCGTTGATGTTGCTGTAGAATATCCTTCGACTTGG
AGTTCATAAGGTATTAGCGTCGTCGATATACGGACAGACAGGCATTGATCTGCTGCTTGATGGTGAGTGGTCGTATCGCTCGATAGTTTGTAGTGTCGAA
TCCACACTGACCTGTACACTGGCAACGAATTATCATAGCGCAAGAGCAGCAACAAGGAGGGGTGACAGGTGCAGAGACCGTGGCGTCACCTCGTCCCCTG
CTTGAAGTTATGAGCGACCCCAGCACCGAGTTCGTCCGTTCGCTTAGACGTTTCTGCAATGGAACATTGGTAGCAATGACCGACGGCGACGTGGTTGTAC
CCTATCCGTCGGCTTCCATGCGCAGTCATAGTCCATACGCTAGCACCTTTTTGACCGAACGCTATATGGATTGGCGATGGCATATCCGCCACTCTGGCTT
CGCTGGAGTGGATGCTTGCGGGCGCACTCACTCTGCATACGCAGCATTCTTGGAACGTCTCAACTCGAAAATCGATACGTCAATTGAGATCGAGGAGCAA
GAACTGGGACTTGATGCAACATGTGCCCCACGACACCCTAGTATTGAAGGCTTTGCCTGCGACAACAAGCAAGAGGTCGAGTTCCCGCACCAAATGTTGT
GTCATTTGCAACAAGTGTTGCCATGGAGACGTATTGACGTGACAGTGGAGCCCTGTGGAATGAAAGGCAAGATGCGTCTACATGACTGGCCAATTAACAA
GATGCAGCCTCCAGACTGTCGTGCGGACGAATTCATTGATCTCCTGAGCGATATGATCGGAGCAGACCACCAGATGCGTCCCTTGACGACGCCAGACACA
ATTGGGATGGTGCATGAAAGCCCTGCACTTGCATTGGCACATCGACTCAAGAATGCTGCCAAGAGAACGGACAAAACGAGTAGCGAAGAAAGCAGTGGAG
ACAGTGATGCTGATGCACATCACTCTGGGATGACGTCGCCCACATCAGGCTCGTCAGCTGCATCCAGCGACACGAACAACGAGCTGTACCCAGTTCGTGT
ATAGCAATGTTAAAAGAAATGGCGAAATGTACTCGTACCACAAAACAACAACGAACATTGCTTTCGATTAAAAAGTTGTAGCACATGAAACATCAGGGAA
ACTTGTCTCAAGCTGCGTTGGCACCGACATTTCATATTTCACTGTGGATTTTTTTCTGCCACTTTGTTTGTTCTTCTAGTGACATTGCAAAACCTTGCTT
CAAGCATTTGGCACTTGCCACTTCACACGCCGTCTTCAATACATCCTCCAGAGGTAGATTTCCGCTCGAGAATTCCGCGAGAGCCGCTCCGATAAAAGAA
TCGCCTGCCCCGATCGTCTCAATCACTCTGTGAAGATGAGAAGCGGGTAGATGATGCGTCACCGACCTTGGCACATCCAGAAAATAGACACCTTCAGCTC
CCCATGTGCAAATAAAGGCTTTCGCATGGAATGCCAACTTGCTACCCCACTGCTTCGCCACTACAGCGTCGAAAAACTGTTCTACGCTTTGAAAGGCAAG
CTTCTCACGAATAAATCCTTGGAAATAAGAGTGTAATCCGCCAGGGAAATGAGCCTGAAAGAGTTTTCCGGTTAGCGTTAGAAATAACTTGATACTAACA
ACAAATTTCCTCAGCGACAAACTTACTTCATTGCAGAAACCCAGTCATTGCGAATTGCCTCTATCTCAACGGAAATTTTTGCAGTAGGCATCTCCTTACG
CACGTAAAGCATCATCTTTTCTGTTGCGCCCAAATTTCTGCCTTCAAAGTGAAACCACGTCGCATGGTTTTCATTATCTTGAAGTTCTCCACGGTACAGT
GTTAATTGCTTCACAAACGCTTCATAGCTCAGCTCGACAAGGTCTCGGGAGTGTATGATGGTGCGAGATCCCGTCGCGCGACTTGAAAGGATGAGCTAAC
AGACACAGCGTCAATGAGTATTTCCTTGCTTGCTTGCTACAGGACGGTGCTCTAACGCACCAAAAACAGCATATTCCCTTGAGTTTCAATGCTCGCAAGC
GAACAATCCACGCCGTAAGCAGCGAGATCGTTGTGGACAAATGCTGCATCGCTGTCCTTCTCGGGGTCCGTCGACACGCCCAGCCAACGGCAACGACTTC
CTAGCTGCGAGCACACAACCAGCGCGTTCGCGACATTCCCTCCTCTGCACTTACGACTCTCCAACGAGCGGATCTGAACAAAACCAGAAGCATGAACCAA
CAACGATTAAGACAGGTGTTGGCTTATTGACCGACCTTCAAGTCTTCTGTTCTCCATGCAACACCATCGAACGTTAGAACCGCATTAGTAAATGGAAGTA
TCACAGTATGAGCAGTGTGATTCACACTGCTACAAGGAGAGATACCTTCAGGGTACGCCGCCACCTCGTGGATCACGTCGATGATCGCGATCCCCACACC
AATTACGTCCATGGCCTTCTATCTGCAAGAGTCGTTCAGAACTTCAACATGTTCGCTTAAGTGCGACCGATGGGATTTACACACGTACATTGCCGTTGAG
TGCATTTCTATTTGTGTCCGGACTAAGATGGCGTCAAGGCCAGACCTGACTCACCGCGATTGGAGAAATCTTCGCATTCTCGTCGGTCTTACGTGCAGCA
GATGCCTTACAACTTGCAAGAGACCTCGCTCCCTGCACCCCAATTCCATGGTAGCGAGCAACATGTTCGTGAACATTCGATGAGCCATACACGATGTCAA
TACTAGCATCGTGTTGACGTTTGCTTCGACACCTTCTCGAAGCTAAGAATAGAATATTCGATCAGAAAATCCAGTGTTGGGTCCAATCAAAGACCGTCTC
TGACATCTTTTCCACCAATAATCGTCCTGAGAATGTGCTGCAAAAAATTGCCCTTTTTCGCATACCGTGATCATCAAAACACTGTTCTCAGCGTGCCGTT
TACCAGTCTACAATTTTCTGCAACAAAAGCAGGCGAAACAAGTGCACAAACAAGAAAGGCAACGACAATTATGAGCACAAGCAACGGCAACGCACCAAGC
GGACCGACGGCCACACATGGCCAGCCGCAGGGTAACTTTGTCTTCTTCATCCCACCACCGCCCACGGTTTGGGTGCAGTTCAACGACGGCATGCAGATGG
CCTTCACGCCGTCCCCGGCGCAATTCCTGCAATCAATGATGCATGGCACTCCGCTGTTCGGTTCGATGCCTGGAAACGGTGTCAATGGCAATGGTAGCGA
CGGCTTTTTCAATGCGCTTAACGAGCTGTTCCAACGCGCACAAGCGCAGCAGCATGGACCGCCACCGACTAGCAAGCCCTTCCTGGACAAGCTGCCAGTG
AAGGTATGGACTAAGGACATGCAGCAGACCGAGAAGCACACGGAATGCGTCATCTGTCTGAGCGACTACGAGAAGGACGAGAAGGTCCTTTCACTCCCTT
GCGGCCACACTTTTCACAAGGACTGCGGTATGACGTGGCTTGTGGAGCACAACGTTTGCCCCACCTGCAGACACGAGCTGCCTACACAGGTAAAAAACAC
CTCGACAGCTCAGGCCTCAACGCAGACAACACCAACGGCCTCGACTGCTGCTGTACCAGCTACCACGGAGCCGGAACGCGAACCTACCTCACAGGAGACT
ACCACAAACGTCACTGGTGTGCGTCGTCAGCGACCCACGGAGTCGTACCACCCGCGTGATGTTCGCCAACGTGTGGACGAGATGCCATCGTCGTTGGATG
AGGAAGTTGAGTTGGATCACATGCTTGAGAAGGAGGCCGACCGCTTTGTCAAGGAGGAAATAGAGAAGCGCCAGATCGCAGCAAGCGACGAAAATGGTGA
GATTGAAGACCGCGACGTGGATGAATTTCTCAACGAGTCAAGCAACTAAAGTGACCGAATTCATT