Description :
From Genome Similarity Track
Location :
Scaffold_16:232936- 235540
Sequence
2604 bases(100 bases per row)
AACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGA
GGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAAC
GGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGG
CCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAG
CGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACC
TTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGG
ACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTCCGATTACGCCATCGAG
TGTGCATTGCTGCAGAGACGACACGGCTGGACAGAACGAGTCATCTCATTCCAGTCCAGACAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACA
AGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGAC
GGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAAC
GTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGG
ACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATA
TGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGAGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCG
GAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCG
CCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAA
GTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTT
GCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACC
GAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCA
AACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCG
CTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGACACCCCAGAGTGCCTCTCACTCCTTGAGGAAACACTGACT
CCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGA
TACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATAGACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGT
GTATTTAAAGTGGGGGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCG
GACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCG
GTAC