Description :
From Genome Similarity Track
Location :
Scaffold_12:232934- 235675
Transcript NameFunction/comments
Physo_108494PREDICTED: similar to 60S ribosomal protein L5, partial
Physo_130643hypothetical protein
Physo_130644hypothetical protein

Sequence
2741 bases(100 bases per row)
CCAAGGTGCACGAGGCCATCCGCGAGGACCCCTCGCCCGCCGCCAAGAAGGACCACTCGTTCGACAAGAAGTACAAGAAGCAGGCCAAGCGTTCGCTCCA
GCAGCGCAAGGCTCGCGTGGCGCAGAAGAAGGCCCACGCCGCCTCGAAGCAGGAGTAGATCTTGTCGCAGGGCTTGTTCTAGCTGGCTGCTTAGATCTCT
CTTCTATCAGCTAGCGAAAATGTCCGCGTGGTGTAGTAATGCACCAACTACAACATGATGAAAGTTCAAACACCTTCCATTCACTTTACAGTCCACCCTT
GGCGTCTTCCTTGTTCATACTGAAGTGTCCATGTCTTGATTCCGTGGTGCCTCCGCTTGGTGTCCTAATAGGTCGTACTTAACCGACCTTAATCCTTACA
CTAGCCTTACCTACCAATACCATTCAAGCAGCCATGTCGTTCTCCATGAAGCTGCCGGCCGCGAAGGGCAAGAAGAAGCCGCTCGGCGCGCCCTTCTCGT
CAGACGGCAAGCAGTACGGGCTCGTGATCCCGAAGAAGGACGCGAAGGAGAAGGTGCGCGTCCAAGTTGCACGGCGTAACTCTCTGTCTACCGCTCATAA
TTTGACGCCAAAGTTGTCGTCCCCATTTCAGGAGCTCGCCACTGGTTTCAACGTATTCGCCAGCGCCGCCGCCGCCAACTCCAGCAAACAGTCGGCCGCC
GCAGAGCAGGAGACGGATGCCAGGCGACGCGTGGGCGCCGAGGCCGCGCGCAGTCTGCAGCAGACGCAGGTGGACAAAGTGCGCGCCCAAGCGCTGGCCG
ACGACCCGTCGGTCTTCGACTACGACGCCGTGTACGACGACATGAAGAGCGCGCGGGAGAGCGAGGCGTCGCAGCGCGCGGCCAAGCGGGAGGCCGAGAA
GAAGAAGCCCAAGTACATCAGCACGCTGCTGCAGCAGGCCAAGATCCGCGAGGTGGAGAACGAGCGCATCCGGGAGCGGCGTCTGGTCAACGAGCGCAAG
GCCGACGACGCGCTCTATGGCGACAAGGAGAAGCTCGTCTCCGCGTCGTACAAGCGCAAACTGCAGGAGATGCAGCGCTGGGACGCGGAGGACGCGCGAC
TCGCGGCGCTGGAGGAGAACGAGGACGTCACCAAGCAGGGCGAGCACGCCATGGCCGGCTTTTACGCCAATCTCAACAAGAACATCGCAATGGGCGGCTC
CACGGACAACGCGCGCAGTGCGTACACGGCCAAGGAGAAGGCACGGGATGAGAAAGCTAGTGACGAACCGGCTAGAGCTGAGCGCGGACGCGAGCGTGAT
CCTGACCGTGAGCGCGAGGTTGCGACGACGCAGGACGAACCTGCGATTAAGAAGACGAAGAGCAGCGGACAACCGAGCGAAAGTCGATCCCCGCGTCGTG
ATGAGCGGGAGAACGTTGAGGCTGACGCTTCGTCGACACAAAAGCAAGAGAAGCGCGAGGAGGCGAAACCGAGCAAGGAGGACGCCATCGCCGCTGCCAG
AGCTCGCTTCTTGGCACGCAAGGCGCAGCGTCAAGCTCCCGGTTCCACAGCTTAGATACAACAATGAAATACGAGCTTTGCTTACGTGGTAGTGAATGCT
ACATGAACAATTTGTCTGTCGAAGATACTTTTGGTGCCAATGCTGAAGATACTTTTTTTCTAGCTGTACTTCCGCTTCAACTGCCTACATAAGAGTCAAA
TAAATATCAAACGCTTCTCGATGCTTTGGCCGCGGCTTAATGCACCGACTGGGTCAAGTGCTGCAGTCCCAACAGCGATGTGGCCGCCAGCAGCTCCAGA
TCTTGAAGTTGCGGGATCGGGTTCTCGTCGTTCGCGTTGCTGGCGCTGGCTTTAGAGCGCTTCCTAGCGGCCGAGCTCTTACGGCGCTTGCTGTCGTCCA
CCGAGGCCGGGGAGCTGTGCATGGCCGACCACGAGCGCTTGCGAGGTGAACTCGGCGGGCTCGGCACAGGCGACGGCGACACCAGCTGGTGGATGTTGGC
CGGCACGTCCAGCTTGTTGCCGCGGGGGCCGCCGCGGCCCGTGGACAGGAAGTTCTTGACCTCGACGCCGGACTGGCGCAGCACCGGCTGCCAGAGGCGC
TTGCGCGCGTTCGTGAACCAGTTCGAGAGCTGCTTGACCTCAATTCCGGCCTCGTTGGCGAGCTCCTCCTTCTCCTCCTCGCTCGGGTACGGGTGGGCGA
AGTGCTCGGGCGAGAACATCCATGCCTTCAGCACGTTCTTGGCCTCCGGGTGGAGCGTGCCTCGGCGCGTGCCCTTCTTGCGCCTCTGCGCGGCCGACTT
CTCCTGCTGCTGCTGCTGCATCTGCTGCTGGGAAGACATCTCCTCTTCATCGGCGCTGCTGGCCGCGGGCGTGGCGCTCTCCAGCTCGTACGAGGTGCTG
GAGAACGACGGCAGCCGCAGCTCGCGGGCGGGCGCGCGCTGCGCCGAGATGGCGAACTGCAGCCCGGGCAGCGGGTTCTTGGCCGGGTTGGGCGACGTCA
CGGGCGCGGGCTTGCCCGTGAGCACGGGCGAGGCCATGGCCAGCGCCATCGTGGCCGGGTCCTCGCTCGGGTCCGTGGGCGACAGGCACAGCTGCGCCGC
CTTGGAGGACATGGCGGCCGGCCGCTCGGGCGTGTTGGAGGCGGTCAGCAGGCGCATGGCCACGAGGCGCGCGTGGCTCGGCGGCTCCATCGTCGTCTAC
TACAGTGCACTGCGGGATCGGGGCTTTGGCTTTGGGGCTTG