Description :
From Genome Similarity Track
Location :
Scaffold_1583:2329- 3348
Transcript NameFunction/comments

Sequence
1019 bases(100 bases per row)
GGGTGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGT
CATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCC
CCGGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAG
CTAGTGACGGGCATTCACCTGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCATGACCGAGTTCGAGATGAGTGAAGACCAGCCCGCCGGACCTC
CAGTGATGACCCTGGAACACGCGGCCTTCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGCCTCGCGGCGGTGTCCGGAGAAACCGTCGTCAC
GTCGCTGCTGAGCTCAGCGACCCCCGACCAACAGCGCCAAGCCATCCAAGAGTTCATGGACCGCGAGCTCGCCGAAGCAAAACGGCGAGTATCAACTCCC
TCGCATGCGTCCAGGAACAATGCCGTCAAGATGGAGACATCCTCCTATTCTGGCGAGGGTCCTGATCGCCTACCTCTGAATCGCTGGTTCAGAGAGATCG
ACATCGCGATCGCCTCGAGGCTAATCGAGGCGCCATCAGCCAAGGTGAACTTCCTGCTATCCCGTTTATCCGGAAAGGCCAAAGAATGGGCTCTCGGCAA
ACTTGTCGTCGACCAGTACGCGTTCCCGACTCTGGAGGCACTCCAGAGCGACCTGCGTCTCGCCTTCGAACCACCGCAAGATGAGTCGCGCGTTCGAGCT
ACATTCTTCGCCCTAAAGCAAGGCAAGATGGCCATGCGCGACTACGTCCAGAGAACGCGACACCTTGCATCGTGTATCGTCACGAAGCCGATCGACATGG
CTTCCCAAGTCCATGTCTT