Description :
From Genome Similarity Track
Location :
contig_188:23286- 25601
Sequence
2315 bases(100 bases per row)
AGTCTGGCCATTAAGGCTGGCTTGGACGCACTCGACAACTCCTCACTCGGACGCCGTGACAACTTCGAGCTCAACCAGGATGAGACATCGGCCGTAATAC
TTCGCTTTTTCGCCTCTTTGTGAAGACAAACAGGGACACACCATCCCGCATTGTTACCGGAGATTACCGATGGCTCGTCTTCATCTACAAGCACGTTTCC
TCGACCGTCAGTTGGAACGCATTTCAAGTCGCACTTCTAAACATAACAAGTTAGTTTGCAATTGACCATGACGTATCAGACCCGAAGCATCCTTACCGTT
GAGTTGACCACGACAACTTGTGGACGAACAATCAGTCTCAGGTACCCATCTGAGTTTCTTAATTCCAGACTATACGCGCTTGCTGTGCTGCTTAGCCCCG
CTCTCGCAGGCGGCACAACAATCGGTTTTGTATCGCCCCTCACATTGAGGATACTTCTGGAGACCATTCCACCAAGCTCATCTCGCTGGTTGGGTCATCA
ATTGTTGCGATTGAAATCACCAACCGGTTGCTAGCCACGGAAAACCCAACGGATCGCTCAACACACGAGTCAAACTTTTGCACAGCTCCTTGGTTTCCTA
GTGGACTGCCGATGCTGACGTTGAGAATATTGGCGTCATGTTTGCAACGCTAAGAATGCGCTCTGTTTTAGTCGGATCATGGGGCGACGATTATCGCAGA
AGCTTGCAATAACTCGGCAACCTTCGAAGTCGAAAATCTGGTCCTTGAAGTCCTTGGCAGGAGTACTGCACTCCAGCAAAAAACGGAGTGGTTTCCGGGA
AGCCTGGGTACTAGTTTGGTGCTGCTCGTACTGCAGCTGGACATCGACTGGCTCATAAGGGTTAACTGCAGATACACACTTTTCACTGGAGGGTGCAATT
TTTACGTTGACGGTTGTAGCCTAAGCACAAACAGAGAAGTTAGTACTCGCCCATCGTTGAACAAACAGGAAAACGCACGTCAAGCCTACCTTTTGAGAGA
AACTGAGTTCCACGGGAATATCCATGGTATTCTCCACTGTCACAGCGGGCCAGAATGACACTTCCATCCACGTGTATCGTCGTGATACGTGCGGTTGCAA
CGGATCAAAGTCCGTAGGTAACACAGTCTTACACTGTACTCGACAGATTTGACCCCAGGCATATTGAGTGGCCTCACCAGGGCTTCCTGACGAAGCACCG
CGAAGCTACACTGTGTTCTCTTGGGACTTTCAGCTTGGCCGTCGCTAATCTTCACAAGATCAAACTCATTAGGGAGACTGCCCTGTGCCGTCACACTGCA
CCAAGAGCCACCGTCGATGCCAAAATCGACGCTCGAGACCGACTCGACCATCACGCGTGAAATGTTGTCATCGGCACGTGTCGATGTACTAGTAGAAAGA
GTACATGCCGATCCATCCAATGAAATGCAGTTGGGATGATGGTGGGCGCTTCTCTGAATAATTCGATTGTCTTGGTAAAGCTGATCGGACCCCGCGCAGC
CATGTTCACGGGCCTCCTCACTCAATTTGAATCGAACAGGAAAGTCGCAGTAATTACGGACTGTCAGGGAAGATCGAAGAGTGACTATCGTCTGCAACCC
ACTCAGCTCCACACAAACCCACAAAAAGCCGTGGCAGTCAAAGTAGCGACCCGTAACAGCGTTTTTCTTAATGCTGCACGGGTCACACCAGCGGGAATCC
TCGTTTACTAGCAGCTCATTGTCACCCTGCATCTTTTCCCGGCTAGATTCCTAATGAGATGTTGGTGTGGATCCTCCATAGCAAAGCGAAGCTGGTAGAA
AGGGCTGTTTGCCAGGGAGAGCCAGCTGTAGGCCGCACTCGTATCAGCAGGCAGCAGCAAACACTCCAAAGTTCCTTCTTGCTGATACCATATACCCATG
CCCGCGTCGTTGACGATCCTTATCCGCATACTTGATAGGGCTCCGTCGATAACGGGTTGAGAGGGCTTCAAATTTGGCTGCAAAAGCCTCGGAATTGAAG
ACATCACCAGCATCGACGTCTGGTTTAGGTACACGAGACAGGTCCAATGAGTGTAGAGACCTCAAGGCCCTTTGAGGAAAGCTCAATCATCGCGTCAACG
GTAGTCCGTGGGATAACAGACACAGTCAGTAGTTGGGCCATGTTGTCCAGGTAAACTTGCACTGCTGACGACACTTGCACATTCAGTGTTCTTGAGTGGC
TGCCACCGGAACCCACGCAAGAAAATTGTGTCATTGAGCTCAGCAGTGATGATGTCATGGGAGTCGTTCGCTGAACCCACATGACTGACAGACAGCGAGG
CTTGAGGGAGTGTGA