Description :
From Genome Similarity Track
Location :
Scaffold_82:2328- 27878
Transcript NameFunction/comments
Phyag_g1734hypothetical protein PHYSODRAFT_534742
Phyag_g1735cyclin-L1, putative
Phyag_g1736hypothetical protein PHYSODRAFT_534684
Phyag_g1737Equilibrative Nucleoside Transporter (ENT) Family
Phyag_g1738hypothetical protein
Phyag_g1739transposase, putative
Phyag_g1740hypothetical protein PHYSODRAFT_342126
Phyag_g1741mitochondrial-processing peptidase subunit alpha, putative
Phyag_g1742hypothetical protein

Sequence
25550 bases(100 bases per row)
CAGTCAGCGGCCATATCAAGATTGCCAAAGTGCTCGCCGAGGAGATCGCCTTGCGCACAGGCTGGAGCGTAGAGCGCGAACCACATACAATGCCATATCC
ACAAGCCAAAGACCAGATATTGACACCCCGAGACCATTCCAAAACCTCGTGCACCCTGTCGTAGctttcaagttgaagtcgaaTTTGGGCTAGAAAAAAA
GGCAAGACCTATTTATTGTCCCGCACATTTCTTGATAATTTGTGTCTTGATGGCCCATCGTTTTGGTACCTTACCGCTTCAAGTGACACAAATCACAATC
ATGCTGGCCGCCGAGAAGCTACgcgagctgcgcgcgctcaTGAGCCGCACCAACGTGCGGCTATTGCCGCTGCGCCACCATCTgggcaagacggagaagg
gGGAGGCGGCGGAGCTCACGGGACGTCCGCTGCAGGCCTTTCTCGTGGACACAGCGGACGCCCATCAGAGCGAATATGTGGGGGACGCGCACAAGCGCCG
CGAGTTCCTCACAGGCTTCACAGGCTCCAACGGAACGGCGCTGGTGACGCCGGACAAGGCGCTGATGTGGACAGATGGCAGATATTTCCTGCAggcggag
caggagctgagcGAGGACTGGACGCTCATGAAGTCCGAGGAGCCCGATGTGCCCACGATTGAGGTGACTAAAATTTGGTCCTATTATTTTTATGCTTAAA
ATACTTATTATACTTTATTGATTTTTGTAGCAATGGGCCAAGAAAAACCTACCGAGTGACAGTTGTTTAGCTATTGATCCGTACCTGACGTCGGTGTTTG
CTGCACGGTGAGTTGGAGAGAGTGGGAAGGTAAACTTGGTGTGGTGTATGGGCTGACTAATATGTTTTTGTTGTAGCAATTTTGCTAAAGCTttgaagga
gacgaagattGAGCTGGTGGCAGTGCACGAGGCTGAGAACTTGGTGGATTTGATTTGGAAAGACCGTCCGGTGGTGTCACCCTCGCAAGTGACGTTCCTC
TCGGACGACTATACGGGCCGCTCTGTTGccgacaagttgaagagtCTCCGCGAAGCTGTTGAGGAGAAGGGTGCTGATGCAATTGTGCTCACTGCACTGG
ATGATATTGCGTGGCTGTTCAACATCCGAGGCAACGACGTCGAATTTAACCCCGTCGTGTGAGTGGAAAAGTTAATTTCCTCCTTTTCTGCTTGGACTAA
TTTTTGTGACCATGATCGTCTATGCTGTTTTCAGTACGTCGTACGCTATTGTGACTGCCGACTCGGCCACTTTGTTCCTGGATGCGGCTAATCAGGACGA
GGTGATTCAGCACCTGAATCCGAGTGGAGTGGTTTGCAAACCGTACTCGAGTATGTTGAAGGAGGTCTCAGCTTTCACGTCAGCGAACAAGGACAAACAG
ATCCTGGTCGACCCCGCACAGTGCAATGTCGCTGTGTTCCTGGCCATCCCAGCTGTAAACCGCAAGGAGGAGACTTCGGTGATTATGGCCCAGAAGGCGA
TCAAGAGTGGTGTTGAAATTGAAGGTATGCGTCAGGCGCACCTTcgtgacggcgctgcacttgtCAAGTACTTCAGTTGGCTTGAAAAAGAGATGGATGC
TGGTCACGAAGATCAATGGGATGAAGTGCTGGTTGCTGAcaagcaggaagagctgcgaaAGCAAGTGAAAGACTATGTATCGCTAAGCTTCGATACCATT
TCGTCAGTTGGCGCGAATGGATCCGTCATTCACTACTCCCCGAAGCGCGGAGATTGCACCAAGATGTCGACTTCCGCCATGTATCTGAACGACTCGGGTG
CTCAATACCTGGATGGCACGACGGATGTGACCCGGACGCTCCACTTCGGACAGCCTACTGCCTATGAGAAGGCGTGCTTTACTCACGTGCTGAAGGGCCA
CATTGCTCTTGCGAGTACAGTCTTCCCCGACAAGATTGAAGGCACCAAACTTGACGCTATTACGCGTGCACCGTTGTGGAAAGCTGGTCTGGATTACCGC
CATGGAACTGGCCATGGTGTCGGCGCGTTCCTCAACGTTCACGAAAAGGGCGTGGTAAGTAACTTGCACATATCACAGAAGCAGAACTTGAGGTTGAATT
CAACTAACACTGATGTCTGTTTAGCTGATGTCGTTCCGCTTGAACCCAAACGGCTTAAAGATCCAAGACGGCATGGTTCTCAGCAACGAGCCTGGATACT
ACGAAGATGGCAAATTCGGCATCCGTATTGAGAGTGTTATGGTTGTGAAGAAGGTAAGGCGCTGCAATTCAGTCACCTCCTCGGTTTCGTTTCGAAAATA
TTGACGGCTCATATCGCATGTCTGTGTGTCAGGCTCCTCAAATCAAGAGCCCACTTAACCGCGAGTTCTGCGAGTTTGAGACACTGACAATGGCCCCTAt
tcagcagaagctcatAGACGTGAGCTTGCTTACGGCCGAGGAGATCACGTGGATGAACGCGTACCACAAGGAGGTGcacgacaagctgcagccgctgttG
AAGGATGACCCTGAGACGTACGCGTACCTCGAGCGCGAAACGAAGCCCCTGTCGCTGGCTTAAGAGCAATAGACGAACTCTCCTGGTTGGCAAGGGCTGT
GGAAATGTAAGTTAAatttccttctccacctccattttttcatcagcaccagcgatCGTCTCCCCCACCTTCTCAGCcacctcttcttcctcaatCGGAT
GGTCGTCCACCGCAAACGGGTTCTCTTCCGTAAGTGGGTCCAACCactccaccttctgctgcttgtacaGCTCCATGATAGTTACACTTACTGCATATAG
CTGCGTCTTATCCACGCCGAACAGCGAGAACCACGGCGGGTTGTCGGGCAGCGCCACAGCTTGGAATCTACTGGCCAGAAAAATAGCAGCACAGGCGATG
ACTTGGGCTTTGTATCGCACGCACAGATCCGTGCGCAGACTGTCGTTGATATAGCCCCAGGCCTGCTGCGCGAGTTTGGAGCTCCCGTCCAGCACTTTAA
CGTAGTACAGCACGTACTTGTGCGGGTGCTCCGTCACATTGTAGACACTGAAGCCCAAGTCGACGAGCACCTGTCTCTCCACCATAATGAGCCACATGCG
CCACTGGCTGAAAGTGgcgccgtccacgtccacgagctgctgcgaaagTGTCGTCCGCTTCCACTTGCGACGTCGGAAAATGGCGTAGAAAACACCGACG
ACGTCTTTGATGCGCTTGggcttctcctccactttGGCTGCCAGAAATAAGCAGCTCACGGCCACACGGAAGACGTCGAATTGTCGTAGGGACTTGCGGT
AGTAGAACCGATGCAGCAAAGTCTGCGCTGTGGCCATAACCACCTGAGGCAGACGCAGTAGAATGCCAGCCTCCTGGATCAGCTCCCACCCGAAAGACCG
ATGCAAGCGCTCGACATTTGGGGGGATTCCGTCATCACAGGAGGGGGAACGggcgagcgacgacgcaggtAGAACGACATGCACGGGCACAGGTCTCGTC
GCCATTAGAATGAATACAAATGTACCGGTAGTGGGGAGATATTGTGATATTTAGTTTTGGAATTGATGTGATATTGTGACAATAACCCATTAGCTGAAAG
ATGGTGGCTTGGCGGATGCTGTCGACTGGGAAtgaggtggaggtgacgttCGATGTGGAGGAAGTGGCGGCGTGGAGGGACTTTCGGATGAAAAGTTATG
GGATTGCAGCGTTGCAAACGTTGCTGGTATCGTTGGAATCGAGTGGAAATGCGGCTGAGGTGGTGATTGACACATCGGAGACCAAGAGGAGACGATACTT
GTCGCTGCCAGAAGCTTATTACGCTGCAGCGATTGACGGCGTTTTGCCCGTTGAGGAGTCATTGCGAGACTTGTGGGGGCGATTTAAGAGGTAAGTTTGC
ATGAGTTCAGATGCACTTTAGACTTTAAACTGGCTGACGCATtgccatgagcagctccagtgcgACGTTCACCAGGCATTTCGTAGTTTACCAACACTTC
CGTCGTCTAGAATGGACGCCGAAGTCTGGGCTTAATTATGGAGCCCATTACGTGTTGTATCGTGGATCAGCTGCGGAATTCCACTCCGAGTATGTAGTGT
ACTTGGCAGACAGTGGCGAATCTTTGTCGTGGAACACCATCCAGTCGCTCACGAGGATTGCAGCGGACGTCAAGAAgactgtgctgctgtgcactGTGAC
TGCAGAAACGGCGAGTGTGGAGGGAAGAATGGCCACCTCCACTAACACTGACCTCACGTTTGGTGCATATAGCTTTCACGACGTCCAGTACAAGGTTGAA
GCTACTGCCATCCGCTTTTGGGACGCGTCAGTTGCCAACGAGCCCCATTCTTACACGTTCAAGCCACAACCTGTCGTCCTGAAGAAAATCAAGActggaa
agaagaagaacaggGTCAAGCGACCAAAAAATCAGTTGGATGGTGACACTCTCACAGGTTCAGGAAATTCCACGTAGCTCGAGACATATCCACTAAACTT
GTTGCAACTAAGTACAGTTAAATCACCCATCTATTCATCCCAGCACCACCTTTTCCAGTACGAGTCCCACCGTCGAGCCCAATACGAGACCAGAGTTCAG
GAAAAAACTCGTAAAGGGACCGATaaggtgctgctcgtcagTATGGACACTTTCACTCACGAAAATGATAGTCAGCGTGCCCAAGTATCCATTCCCAAAT
CCGAGAACGACAACGCTGAGCACGGACCAAATGTCGCTCTGGAGCCACCATTCCTTGACAATACCGATAATGATCGGCACTAAGACGAAACGTGCCACAA
TTGGGATCCACACGTTGCGGGGCGTGAGGCCGAAGCGGTGGTTCACAATAAATCGTCCAACACAGTCACTGACAGAGAAGAGCGTGAGCAGGATCAGCGA
CCACCATCCACTCTCCTGAAGAGACGGGAAGTTGTACGTCTTGATCTCCGTGATGAGCGGCGGCCACACCGACAGACTGGCAAGAAAAACAACCAAGATC
AGCACCTCCAAGTGCCACACCTTCCTCAACACACTCCACTTGGTCGGCGCCGGGCCTGGGACACTAAGTGGGTCGCTATCTGACTGCCGCTTCTCCTGCA
ACAGCGGCGATCGTTCCGTAAGTTCCACACTGCTGTCTGCCTTCCGGAGCAAATACTTTTTGGTGATCCGGAGCCCCATGACCTTGTAGAACGCGCCGAT
ACAGAGCAAGATGGTGAGTGCTCCTGTGTAAAAGTAGATTAGCGACGAAGCCAGTAGTTCATTAGCCGGGAACACGAGCTTGGTCAGGTCGCGATAGAGA
CTGCCGATGAGAGTGCTGATCCCCACCCCGAGCTGGAAACTCTCCTGCACTCGCTGCGGATACTGTGACACAAGAGCGATAGTCGAGCTGTCAATATACG
CTGTGGCAATGGAGGCCACGGCAGTGCCACCTAACACTGCAATTGCATTGGCGTTCTCagacgtcaagaagaagtaggACGTGGGCAcgaagaccaagac
caaCAGCTGCCCTACGAATCCACCAACAATGCGACCTTTGTACCAGGGCTTGCCGAACagcacgacgatgacgccCAGGAAAACCAAATTGGTGTAcatg
aaggtggaggtgaGCGCGAACTCGATGTTGAAGTCCGGGAAGAGCAAGTTCCAGTAGTCCACGGGCTGTGTGAGCGCCGAGAAGGGGAAGAGATACCCCA
CACCCACGAGTGCAAACAGCCAACATGCCGACGTCTCCTCCTGCGCCTCCCTCACAGCGCTCTGTACGCTGCCGTCACGCTGGTCTTCGAGTGGAACTTC
GGTGTCATAAGACAAGGAAGAACGGCGGATTCCCGGCGTGCGGGGCAGCGGCGACAgcatgacgacgaagccacttgagctgcttggcgatAGATGTCGA
ATGACATCAGTCACGCAATTCTGTATCATGTCTCAGATTTTACGCTAAATACGAATTCGATTTTGTAGCCATGCTTGCGATTCTTCAGCGGAGTTGCAGG
GGGGGGGCAGCCAGTATACAAATTTCAAGTATAATCGTGATCACAATAAGGTTAGGTGTAGCTAGTGGGCGTGGAGTAGTGGGAAAGCGCTAAAGCTAGA
ATGCTGGAATGGTTAGATTTCTCTGAGAAATCTACGAGACCTACGTCCGTTGTGAAACTACAAACAATGACGGATTTAAACGGCAATGCAAAAGCCGGCA
CTGGATAGCCGAACCCATAGTAAAATGATAGTATATTTAAGCCAATCCTTGCTACGGAATTCAATCTTTTTTTGCCAATGCGAAGTAATAAATATTTGAA
TGGTTCTCGTAAAACTGCACCTGACAGTTAGTAACTTTTGGTGGAATTCTCACTTTACATTCAGTGCTATGGACAACGAGACACctaagaagaagcagag
gacTTACACCGTGGGTGAGAAGCGAGATGCCGTCCGCCGGATGCAGCAAGACGGCGTCGAACAGGTGGCCCGTGAGCTACTGTGTGCACGAGGAACAGCC
CACgggtggtggcagcaggcAGACAAACTGCTGAGCTTCACGGGCCACCACACTTCCAAGACAATGAAGGGGCAGGGACGCAAGGAAATGTTACCTGACG
TCCCTGCCATGGTGACCTTCATGAGGGACAAGCGCCGCGAAGAGAAGGTAATCTGTTTTAGTCATTTTCTGCAAATTTATTGTACTTTTAAATGTTATTT
GTGATGTAGGCTCTTACGACGCGTGGTATGATGGAATTGATGTGGCACATAGAGAAAGACTGGGTTTCTAACTACATGGAAGACAAGAAAAGCGGTCTCT
TAGCACTGCAGCGCATGTGCGAACGCCTCGCCAATCGATACAGGCTTTGATATTTGTAAATGTATAATGTCTAAAGTAGTATTTTATCTTAAATATTGTG
TTAAGCCACGGTTTCACGTCCTAGAAGCCACAGacaaccaagaagagcacaGACGACCTTGAGCACACGCGTGCCGAGTTTGCTCTTCGGTTTTGGACAG
ACTATGCGGCGTTCAGTCCCGGGGGCATGTACAATGTTGACGAAACAGCCGTTAACTTTGACATCCCCCCAGCGCGGATCTGGGCTGGGAGGGGGCGACG
TGATGCCGCCCGACTGGCAAACACGTCCAAGAATGCTGGGCGGatgacagcagtgctgaCAATTCGAGTGGACGGTGAGTGTTTTCGAAGTTATTGTGTT
TGTTGAAACATTGTTTATAAATTTTGAATTTGTATTTGTGTTTTACAGGGAAAAAGCTACCAATTCTGCTCATCGTGCGTGGCAAACAAGGTTGGCGCAT
TGAATCAAGGGAGTTTGAGGACTACCCAAGCGGGCACTTCTACACAGTCCAAGAAAACGTGTGGATGGACGCCATTACCTGGTGTTTCTatgtcgagaag
ctgctcaagttcgaGATCGACGGACCTGCCGTCCTTCTTTTCGACAATTTTGAGTGTCACGTGTCTGAAGAAGGACAGCGGGTCGTTGCCGAAGTCGCCA
ACGCCACGGTGGTGCCACCGCCTGCTGACAGCACCGCGGTGTGCCAACCcctggatgtcggggtgaTGGGGCCTTTGAAGGCAAAACTTAGGACCAATTG
GTCTGATATCACGGGTGGGACTGCCAAGGAAAAGCGTATTCGGGCAGTTCGGGCCACAATTGCCGCCTGGGATGCCATTCCTGGATCCGTAGTAATTCGT
AGCTTTGAGAAAGCAATTCCTCAGTGTCCAGAGATTAGCATTTGAGTTAAAAACAGCGTTTTTGCAAAGGTGTACGGATTTTTGATCTTTTTTTGTCTTT
TACTTTTCGCTTTGACCAATCAGGTTGGTATTTTCAGCCGTTACCGGCTTTTTCATCACCCTGCCCACCATAGAGGATGTCATTCAGTGGTGCCGTATAA
atccgtcgttgtctgtaTATATATAGCTGGACATTACTTTTCGACAAACTTTGATATGCCTATGTTTCAGGTGTCGTGAACTCGAAATCAGACCAATCCG
TGAGACTATCTACGTCGTCGGTATGTTTCTTCCCTAGACGTAAAGTGATCAGGATCAACATTGGAATTACGTGTATGGCTTTATGTACCGCTCATAAAAT
TTACcataataataataataattTGCTAAATATTGTGAAAAGCACTCGGAATGTCTAATCGGATTGTAAATCAGTCATTTTGGTGCCTTATTTAGAGACG
TCAACCCTTATTTATTTTGGTCTCTCTCTTACTTAGAATTGGGAACTCCTGTTTAGACCCTGTCTTGTGTCATGTCTCAAACGGCATGGCTTCAAAGCTA
TTTTAGAGGCGGAACCGATTTGGTCTCTAAACAGGCTGGAATATCAGCGCCAGCCACGGCATTCCGAGGTTGTGCGTTCATATAAATCTGTCGCGAAAAC
CATAATGCAAACGCTTGCCAAAATCTCAGTCAAAATCGGAGGAATCAACAAGGCAAGCAGGACAAACGTCCGCGTTGAGAACACAGAATTTCAATTCGAT
TCAGAAGGCGGGTCTGAAGATCTCTACGCTAGTGCTGAGGAGCGCGTTGTAGCAGCGCTAGCTGCGTTCGATATTAGAACGGTGCGCCCTGACACTACCC
TTTACGCTAAGCCAAGCCAAGGTGCCACATAACAAGGCTGGGTAGCTTTATCCGAGTCAAATTGGACAGAGGTTGTGACGACAGTGATAACTAACCGCCA
GCGGCGCCGAAAAGATACCGGGCCACTGTGCTTGGAGCTCTTTGCTATCGCGGTCAGGGAGAATCAAGTGGGCGAAGCAACACGCCGACGTGCAACGCGC
AATCGCATTCAACAGGCTGCTGAAGACATTGACGACTTCCTCGTGGAGAGAACTGACGTCCAAGTTGGCGTGATAGCTTATACGCACTGGGAGATAACCC
AAGCTCTCCAACCAGCAGGGACTCCCGTTGCAATCCCCGAAACAGCAACCTTTaggcagatgcagcacttggatgccgttggtgctgcaaaCCCGGCCCC
AGACCATGATGAAGCTGTGTACCAGACGATTCCCGTTCGTATCAACGGCTCCTCCGAGCTACGGCTTACTATTGATGTGTAAGGGCTTCGCGTTATACTT
GGTTTACCTGGGCACAATGCAATGGGTAGTGGGATCTTCTCGGAGTTTGTCCTGCCACCAGAACCGGAGGAAGATATAGAGGATGTTGACCACCAAGACG
ACTAGAAACAGGGCAAACATCCATTTCCCTAATGCATTTTTCCGATTTCAAGATATTGCTCCCTCGCTATGCTCGGGTATTGACTCCCGCCCACCCCGCG
GTCACCGTGTATCTTCAGCTCGCGGGCGAACACGCTGTGTTCCACGCCTCTATCTCCATACCCGCAGTGACGGAAAAAATTAACACCTACGTCCTCGCTC
TTCACGCATTGTTACTTTCAACACCAGCTCCGCGTACATTGGAAACACGAGATTCGCGTGCCGAGCCAGCCATCACTTCAACTGCCCGAACATAACCTCG
ATGGGGTTGAACTGGGGGCAATATGGAGGTAGGTACACGAGTCTTGCACAGCAGGCGTGGACAGCTGCCTCTAACTCTCCATACATGTGAATACGCGCGT
TGTCGATGACCACTATCGACCGCGGTAGTGGCCACGGGTCCAGCTTTGGCACGACATCCCGAACGAAGGCTCTATGAAACTCCACTCGCGTGTACGTTCC
ACCAGTACAGTTCCACGACAGAAAATCGCTCCCGTCACACGCAGCTAGAATGCTGACACGCTTCCCGCGTGAGAACGGGACACGTACAATTGCAGGTGTT
CCTTTCGGCGACCAAGCATAACGCCGCATGCTATCGAATCCGTTCTTCGAGGTCTCATCCACGAACACGAGCTGCTCTGGGTACTTGCACCAGCACTTTA
TTTTCGCGAGAAAGTCTTCAATCTCGCGAGGAACAGCCTCGCGAGCTCGACGCTCGAGTACCTTCCGCGACAGACCGAGGTCGAACTTgagcaaacgcag
cagagccGTCGCGCTGAAGCCGCTTGTGTTAGGGCCAAATCGCTGACGAAGGGCGGACTGCAATTCCTCCACATAGAAACACGGGTGGACCTTGACATAG
TCAGCGACAAAACGCTGAACGTTGGGGGGCTGTCTTGTTTTCTTCTGCCGCTTACCTGGCATTACGTGACCAACACGCTTGAACTGTTGATACCACCGCA
GCACAGTTCGGTCACTAATGCCAAATATGTGCCCGGCTCGCTTACACGGAACACCGTAAGCGTAGTGCAGAATCACAGCGCCCCATCAGAATTTCGCTGC
ATACGTCGTGTGCCTTCCGTCTCTGATTGTGTTTCGCTGCAGACTAGTGCTATTTAGATTGTAGTTCCCAGCCCGATTTAATGCCGCGTACCCTGATTAG
TACTCTGATATTGGTCAAATGCTGGCTGAATTAGCAAATAGCTTTTCAGCTTACAGCTCCGATTTAGCGGGCCTTCTGGCAAGACAAAGCAGACGCTTTG
CACAATAATTATTTTGATAAATTTTTATCACCGATCGCACATTTTCCACACCAACCAATAACGGGTACCACAAAACTTTCCATATCGCTGTCGATCACCA
CCAAATATTGCCGCGTCTCACGATGCTGCGGACTGTCAGCATCCGCTGCGCATATGCAGCACCCAGCGCTCGACTCGCTCCGGCCATCACTCCTCCAGTA
TtctccgccgccttctctTCCCCGGCCGCCAACCGCCGCGCTCGACGCCTCCGCAGAGCCAAAGCTAGCAATGATCCGTCCCCCGCCGACCCCCGAACTC
CATCCATCCTCGCAGACATCGACCAGCTCTCGCGCAACGGCCTGGCGCAGCGCGTGGAGATGTCTAAAGAAATGCTAGACCGCTTGACGGCCGTCGTCCG
CAGCCGCACGCACTCgcagctcgagacgctgcgtcaGAAGCACGTGGGAGACCGCCGGAATAGTCGCCAATTGCCATTGGACATGAGCAAGACGCCGCTG
GGCTGGACTATGGACCGCAGCCAGCAGATCCCTCCTTTTGCCTACGGTCCGGCCGAGACGCTGGCCTTCCTGGCCTacgagatggaggccacTTACGCAT
GCACGCACGCCGTGTTCACGGAACTACAGAAGCGACTGCCTGACTTCAAGCCCAAGTCGGTGCTGGACTTTGGTGCCGGCCCCGGCACTGCGTCGTGGGT
GGCCAAGGACTTTTTCGACCAGTCACTGGACAAATATCGCGTTGTAGAGCCTAGTCAGTCGATGGTGGACGCGgccgaggtgctgctggaaggctTCCCT
GGCCTCAGCATCCGTCGCGGCATTGCAGACATGTCGAGAGATATCGACGCGGGTAATAAGTACGATCTTGTTGTGGTGAGCTACGTGTTCTCCGATATCA
CCAACGACTTTGAGCGGGTGGCGACGATATCGGCGCTGTgggagctgctgagcgagaacGGGTGCCTGGTGGTCGTGGATCGTGGAAGCCCGTGGGGATC
GCACCATGTGCGATCGGCAAGACAGTTTGTACTGGATGCGGtggctgaagacgaagatggaaAAGAAGGTGCTCGCATTATTGCGCCATGCCCGCACCAC
TTTGAGGTAGGTTGTCTGAACGACTTTGTCGGTGATGTCTGTGTTGCACAAAGCTAATGTGTGTGTTTTATGACGTCAGTGCCCAGCGGCAGGAAGTACG
TGGTGCCATTTTGTGCAGCGTTCGCCAGTAGTGAACCACCCTCGTGAGGCCACCACAAAGCGCTGGCACGGTCAGAAGGGCTCCAAGTTCTCGTACATGA
TTATGCAGAAGACCCGTAAAGGAAgtgacgaagatgccgctgctaagaagaagaagcccatcGCGCGCATGCTCAGAAGTCCATTGCTTGCTACGCGTCA
CGTGCACCTTGATCTGTGCACACCTGAGGTAAGAAAGATTGCCAGTCAATTACTCTGTCATTCTTTGAGTGGAGATTTCCAACTAACACTGGTATTATTT
CCAATCATGCAGGGAAAATTGGAGCGTCGTAGCGTTACCAAGGGTAAGTCAGTTCGTGAGGTGTATCGTGCATCGCGTAAGGCCCATTGGGGAGCCTTAT
GGCCAGCTGACGAGTCTAGCTACCTGAAGGACAAGTAGAAATGAGAGTTGCGTTGTCATAACTTACTTGGTGTGGCAAATAGTTGCAATGCCTGTCAAGG
ACGTGGCCGAGTAGCAAACAACAAGTGCGAAGTTTGCAAAGGGAAAGGATTGCGTCGCGAGTCTACCACGCTCACTGTGTACATTGACAAAGGTGTTCGT
CACGGTGACGAACTTTTGCTGGCTCGCGAAGGAAACCAAGCACCACTCCATGTGCCTGGAGACATTGCTGTGCATGTGGTAAGGTTGTTGCCGCCTAATA
GAAAAAAGGCAAGACGCCACGTTATGCTgatcgtgctgctgcagataaTGACCCCACATCCAGTGTTTACTCGACGCGAAGACGACCTGGAGCTGACGTT
GGACATCACACTACTTGAGGAACGCCTGGATCTGACCTCACCGCCATATTGCGAAGATTACCTGTGGACCTTGTTCTCCTCTGTAGGCGTTGGTGGGGTT
TTCCAGGGAATTTGTTCATCTTGACGGTCGCGTTGTCAAGCTTACTTGCGACGCTGTTGTCCAGCCGACAACAGTCTGGAAGATCCCCGACGAAGGCATG
CCTCTCCGAAACCATACAGGAAAGTTTGGCTCCTTGCTCGTCCAGTTCAACATCTTATATCCAACCGAGCTAGACGCTGCCGCCAAATCTGGTAAGGACA
CAAGAGTTCTACTGCATCTACGCCAAGCACAACGCTTACCTTCATGTCTTGCAGCCGTTTGCCAGCTCGTAGGCGACTGAaagcgaagcagcagaaccgc
GAGATTATCGTTAAAAAGTTGGGCTTTTTCTTGTATTTAGTGCGCTCTTCGCACGCTCCGTCACCTCGGCGCTAGACTGTGTCTGCGCAATGCTCTCTCT
CCGCTGTAATTCCCCTTCCAAACTCGAGAGTTCTACCGCGTCGTTGCGCTGCATCCACACTCGACCTGTCCATTCCAaggtcacttcaacatacGGTCAC
CAAAAGCTCGGGTTGCTAAACTGATGTATGTACCTCACTCTTGATCGATCGTCCTGGTCGTTTACTGCAGCTTGCTGGCAACCGCGTCCACGTGGGGCAC
GGCCGACAGCTTGCCGATGGCAGCCACAGACGGCGTGGCCTTCAGTGCCTTCTgagccagctcctgcagcttggcggcggTCACACCCTCAACAAGTTCC
GACGGCGACTTGGACACGAAGCCCGTGGTGGCGATCAGACCCACGCGGCCCAGAGTGCCGGCCTGGGAGCTGTAGTTCTCCAGAGCCTCGAGGGCAGCGG
TAGTCTTGGCGgcagccagctcctccttggtaGCCGGGGCCGAAGcggccttcttcagctcagCAGCGAACGAGTCCACGAGCGCGCCAGCCTCCGAGTG
GGCGGCATAGCCCGACAGGCCAACCAGAGCGGCGTCGCTGTAGCTCGACAGGAAGGCCGAAgccttcttgttgttgagtcgcagactcagcagcgcgcgc
agcacCTGCGAGGCGCCGAAGTCGGCAGAGTCGCGGCCAACGGTGGGCAGCGCCAGAGCCACGTGCGTGAacttggcgttcttcttgacgcgcGTCTCGC
CACCGACGTACTTGGCCGAGGCGCGAGCGGCCTTGCTGCCCTTGGTGAACTCGCCGAAGTATGCGTTGGCCAAGTCCGTGAGCGTGCTGTGGGCCACACC
GGCACCCACCAGAGCGGCGTTGGCCGTGTTGACGTACTTGTCGTAGTAGGCCCAGAGCGCCTCGGGGCTGAGCGCGTGCAGGTTCTCCACGTTGGCCAGC
GAGCGGCCGAGCGTCACATCGTCATAGAACGCGGCGGCGTGCACGCCCTCGAGCAGCGAGGCTGAGGCGTTCTCGTTGATCTTGTCGGCCTCGGCCTGCA
cgagcttgtgctgctcctccacgtcgtaGAGCGCGAACTTGGGGGCCAGCGTCGTCTCGGCCAGGATCTCGGcggccgcctccagctgGTCGGGCAGCAC
GCTCACGCTGTAGCGCACGAAGTCGCGGCCGGCCTGGGCGCTCACCACGCCGCCGATGGCTTCGATGTCGCGGTACAGACGCAGGTCCGAGCGGTTCTGC
GTGGCGCGGAAGGCCATCTTGGCGAACAGCTGCGACACGCCGGCCgtctcgtcgctctcgtcgcgcGCGCCCGTGTTGAGCTGCATGCCGATGGTGGCCA
CGGAGGCCGCGCGGTCGTCCGAGCCCAGCGCCAGACCCGACGAGGCCGTGGACGTGGTCAGCTTGGCCGCGGCCGCGGCCTGCGGGGATGCCTTGGGCAC
CGACGGGAACTCCTCGCTCAGCGCCACGCTGGGCATGGCGCTGGCCTTGGTGAACAGCGAGCGCGACGCGCGGGCCGCGAGCttggaggacgacgacgcg
agcATCTCGGCGGACGGGATAATAATGTGGGGGATCGCGTTTCTgtgcttctggtggtgagGCGGCGAGCTGTGAGGCTCTCAGAGCCCCACGATTCTCA
TGTGCGGATGGTGGCGCGATGCGGTCAGTACAGTAGAGATTGCTAGTGGCACAAACCACACGGCGTCTTATTTCTCATGCTAATTTCCGAAATTCACACA
AAAAATTGTCACTGAACATACATTTTCATCACCGATCAATCTTTCGTGTCACCGGACACGACCTTTCGTGCTCTCTGCCGGTCGAGACGCAAAATTTAGA
GCGGAAGATCGGAAGGCTTCGTAAATCCAGGGCCGCGCCTGCGTCCGCCGCTTGTGTCCATAGCGagaaaagcagcaggagaaacaAGTGCGCAACCACG
TCcgcagacgatggagatgcgGCGCGTCGTGGCGCGCTTCATGGTGCACAAGGTGGGGAGTTTCGTGGTCAAGGAGcgcgtgctgagcttcgGCGAGTAC
TCCTTCTCGACGCTGGATCGGGAGAACCAGCAGGTGACCAATACGTGGCCGTACGAAGACGTGGACGGCGCCAACGTGCTCGAGGGCGAGACGGACTTTG
TGATCCACACGCCGCGCCACCGCATCAAGAAGACCGTGTACCGCTGCCACTTCCGCATGGAGGTGCTGGTCTGTCTCATGCGGCTGCGCAGCCAACACTA
CGCCAAGATACGGGACGcgccgcagccgccgcctccagagctgcagacgcacgCGTTCCAGAGTCTAAAATATCACAAGAGCGGGGTGCAGTCCACGTGC
GTCGTGGAGATCCGCCCCGACGGAATCTACCAGAGAGATAACGAGGGAGATCTCATGAGTCATATTCCTTACACGAGTCTCGTCTCGATTGATCTCATCT
GCGACGACCACGAGGCTATTGCACTGAACCACTCAGACAATTCCAGTTTGTTTATTGTGCCGAAACGTACGGAATTGGCTCAAGCTATTAATCGAGTGAT
GAAGGCTTACGGGATGCAGATCAATGAGTACCGTAAAAAGACGATGGATGCGGCGTTGAAAGACGACGGAAAAGCTTCGTTGACCACTGGGATATCGTTC
GAGTATCAGGTTCTAAAGGTTTCGCAGTCGAACGAGTCCAGTGCTGCCCCAAGAACGCTGTCGGTCTCAGAGAAGTACATTGCGGAGTATACAGATGCTA
AAGCGGTGATTTCCAGCCGCCCCTTGTCAAGGATTTACAGTTTGATCATGTATCAAGATACGTTGCAGGCCTTTGAAATTGTGTATGTGGATGGAGTGAG
ACGCAAGTATTATTCCGCTCAGAGGGAGAAGATTGTGTGTGAGTTGTTGGCATCGTGTCACGCGCTGGGCAATTATCAAGTGGGGGTGGAGATGACGGAA
GTGCCGGATTCGGTGCGCATGATCCCGCGCAAGATTATTTTGCAAGAAGGAAACAAGATTGCGAACACAGTGCCGAATGTTAGCGTGATGGATCGCGAGC
TTCGTGTCGCGCAGGCAAATGTCTTGCAGTTACTAGTGGTGCATGGCAATCGGAAGACTGCACGAACTCAACGACAACTTCCTCGAGGCCTCGACGAAGA
AATGCACTCGTtggccatggagctcaaTACCAACACACCAACGTCCGGTGTGATTGCACAGCCGAACAAACCTTTCGAAAAAGTGCTTTACGTACTTGCA
CGCGAGCTCCATGATATCGTAGGGCGTCATGGTGCATCGCATGACTTCGTGAGCACATATCTCCAGTCACTCTACCGTTTGACTCTCGCGCCACCGGCCA
TCAACGAATTCATGAAAATTCTGACGGAGGTACATTGGCTACTACACTACTGTGAAATCGAGGTATCACATCTAATTTAAATTCCGATGTgcgtgttgtt
gttgctagCGTGGAGAAGAATATATCGGCACAATATCCAAGGTATTGGTGAGCAAGAATTCAGTTGCTATCTACTGGATGTTCATGGTGTTGAGTCGACT
AATGGAGTCAAAGACACACAAGCTGCACTGTCGACAGCTATTGCTATCCAATGGTGGCTTCATGATGACTCTTCTTTCCCTGCTAGACGAAGATACCCAT
GTAAGTCCTACTTGTTGATACTTTCGCTGAGTAGAATGTCTAACACGAACTCTATTCGTGTCGTGTAGACGGGGTCTTTCTTGTCTGATTTACCGACCAT
GAAGCTGTGCCAGTTCATTTTGCTTCTCGTGAAGGCAAATGTTGAAAAGCAGCGGAAACTCTCAGAAACGCTTTATCAGCATTTGGCAACAAAGTATCGT
ATGATGCTCCGAATCCTATTTAGTTTTCCTGGATTGGCTACAGTCGAAGCTTGCGTGGGAATTCTCAGCAGGATGACGAAAAACCCGGCGTTTCTGCACT
TTGGTAATATGGGCTCCCCGTTGCAGTCCAACGATGGGCGGGTCCCTCGGCAAACCCTCAGCTTCGGCGAAACGCTCAATTTCGGTCCGGGTAGTCAGCG
TGGAGCACTGTCCTCTCGCCCCCCTGTATATTCGTCCCGACGAAATAACTACCTATCAAGCCGAAGCAACACACTTTCGTCAACTGAATCTTCATCTAGT
GgtgcaactggagctgcatctAATGCGGTGATTGTACAGAACCCGGAAATTCTACTACGACAATATCGGCAATttctcgaagcagcttgtggGTCCCTGA
AGATGGGCATCGATCAATACGACGACCCAGTGTTCCTGCGTCTTCGATATCGTTGCCGCAATATTTTCTTGCAGGAGCTCATGAGTCATTTGGTGGGTAA
TTTTGAGGAATTTGAGCGCGTGTACAGCGTTGACTGCATCCAGTTTAATGGCTTCATCGGTACGACAAACGGGCAACGAGATAAGACCAAGTTTTATCTG
ACTCCCCGAGCTCTGATTGCCGTGCGAATCGTGACTAAACATACTCATGAATTTGAGTACCGCATGATTGACGAAATTACTCGAGCTACTGCAATTCCAG
GTGCGTTCATACTTACAGTGaagaacaagttgaagtttatCTACTCCGACCAAAGCAACGGAATCGTAGAAAAAATGAAGTCGTTAGCTGGTGTTATCGG
GATCCATCTTCGGTTCAAGACGCGGGATAAACTTCCAAAGCAACCGCTGGACAAGCCACTCGACCAATCGGCTTTTCAATCTAATGACTTGTTTGACATC
CAGAGGCGAACTGGTCGGCATGGGTCCACACACTTGCGAAAGAAAAAGCTTTGCTTTATTGACGGAACCATTGAAGAGTTCACCAACTGTTCAAAAAAGA
TTTATGATCTAAAAAATTTGCGACGGGTGGTGGTCCCAGGGTTGGGAAGTGACGACACCCAAGCTGTGATAGCGTTGGAGTTTTCGGACTGCAGTCGCGT
AGTTTACGTTCCGTACGATATGGAGAAGTTCCTGGCAGCTCTGTACGATGGATACCGCTATGTCGAGAACTATGATGTGTCGTTGAGCAGAGAGTTCCCG
AAGCTAAACCCGAGAATGTCCCCAAGAGCACTGGTGAAGGATGAGCATGAAAACTTTCTCTACCTGAACCATGACGGATTGTACATTCCCGCGCACGCTG
TTTTGGAGAGAGAGATTGAAACTATGAATGGAGAAGGCGTAAGTATCACCTCTGCCACTAACCGAGTTACGTTCGCTCTGGAGAGCTTGAACATGAACGT
TGACATGGAAGATTTTTCCGGAAAATCCATGCGTGGGCGGTTGGAAAAGCTGTCTTTTGGTCCACTTCTCCGCGGGATAAACAATTTGGTACGATGTCGC
TTGTTGGAATGGCTTTGCTAACACATCAGTTCTAACGCGTTGTTATGAATTTGGTGACAGTTGGAGCATTCCTGCAAACCACCGATTCGTGCGAATGAAA
TCTGCGTCATTTTAGAGACGTTTTGCCGCATTAATGACGGTTGCTACCGGCTTACAATGGAGCAGTCAAATGGCGGTGCTATGGTACTTGTTCCAACATT
GGCTCAAGTATTGGTCTCTGGTGATCCTATAGCAACCGTGTGGGCTGTGAATGCGCTTCATTCGCTGATTGCCGATAAATCACGTTCAAACGCTCATCGA
GCAGCGGAAAAGGCTATTCGGTTTCAAGTATTTGAACATCAGAAACTTATATCGTTATTGACTGATCTATTGGAGCAACGAAATCCAACGTCTACGTTGG
TCATGCTACAACTAGTACTGGATGTACTGGTTGTTTCTCGTCACAGTACCGACAACAACCACTTTGATACTATCGTGAAAGCGCTCGGGGGAAAGTATAA
TTTGCTGTTAGAATTAGCATCTCAAGACGTGAATGCTGGATTGGCTGCGGCTGTTATTTGCCTGTTGAAGGTGATTGTTGATCATGGTGATCACAGGGTG
CGACGGCGCATTTGTGACGCTGCGTTGGATTCTGGTTTAACTTTAAAACACCTACACAAGGCGTTTTTCCACCCTTCCGACAATGCCAAGGAGACATACC
AGTATGTTGCAAGCATCTGGATGACGCATCATAAAGCCTCCCACGAGATGCTCGTTAGAGTTCTCCCGCATGGATTTATCCGAATGATTTCAAGTCCGAT
GGTAAGGAAACTGCTAAAGAAGCAGCGAGCTCGACAAACAGAGTCGGTGAGGCGAAAGAGCAAGCACCAGCTTCAGGGTCACCTTGATGGATCCGAGTGG
TTTATTCGTCGGATGCAACTCCAAATCGGAACCCTATTTGCTAGTGGTTCCGTGAAAGAAGCACGCGTCAAGGAAGATCCCACGCGTATGAACTATCCTG
GTGAATCATCTACCGACATGGCTCTCCTGTCAAGTATGGTCGGCAAAGATTTCCTACTTCCTGATCTGATTTGGAACGAGCTAACGAGAGGTGAATTGAA
AGCTGCGCTAAAGTCGGAGATCGATGAATTTGACCAGTTCAAACTTAACCAAGCAGCGGCAATATCCTTGGTTGCTTCTCGTAAAGCAAGCAGTGAGCCA
AAATGGAACCATGCCCAATTTTCGGTAAGGTACGAAAGCATTTCCAAAGAGCTTCAAGTTGACCGATTTTATTTGCGCGTCATCACGGAAAGGATAAACG
ATGGATCTTTGCAACTTGCGGAAGTCGCCAAAAGCGTTCGTTCAATGGAAGCAGGAACACATCGAGGAAAGCTGAAAAAGTCGAGCAGCCTATTCTTTGC
CAGCATGGACATCGCGAAGGACCCAGCAAAATTTTTCAGCGAAGTGTATCAGTGTTGGTTGGAGCATCTTCATCTAAACAATATTCCGTTATCCGGAACG
AACGATTGGTCCGCAAGTGGAAGTAACGGGTTTCCGACATTTACTGGAGCGACTGGAAACGAGCAGCATGGGCATTCCATGCTGAAAATCCTTATAGAAT
TAGCCAATGTGTTTCCCGAAGCGCGACCTATTACGAAGCACCGGGCTCGATTTCTTACTGAGCTGCTACGGAATTCATATCTTGCGAGTGAGATCCAAGA
TATTGTGGAGTTGATGGCTGGATTAAGTCTTTCTGGCGAGGCCTGTGCTGAGTTGTGTACAAAGAACCACATCCAGGTACTGTTGTACATGTCGATGCTG
TCTCACCGATACCAGTCAGCACCACTACGAAGCGACGTGACGAGCGATCAAGGAGATATACCCATGATGGACTCGCTGAATATCTCGGAAGGCAACGACA
CCTCCTCCGTTCCGATAGCTGAACTTTCCCTTTACGACGAGTCAAGGTATGCGCTCAGATGGAGTATCAAGCTGAAGGCTGCGGGAGAAGCTGATGAAAA
CAGCGCGGTTAAAGGTCCATTTTCAGCGTCCGAGTTAAAGGAGTACCTGGATGCTGATCCTTTTATCCGACATCGCCAGATTGATGCCCTATAcgtatgc
tgctgctctacaCATGATCATGAATGTTCAGACAGCGGTGGGCACTCGTGGAAGTCGATGTTTGAATATCCGGAGTTACGATGGATGGAGCTAACTGACG
AGCCATCTGACACGAGCTGTGCAATGTTCGCCCTGAAATCTTTGAGGAATTTTATGGTCAAAGACCAGCGTTCAGTGTCGGATGGAAAAAAGAAAAATAT
GTGGCCGCCTCCGTTGGTAAATACCGTGGTAGCTAATACGTCATCACTAGCCCTGTTGGTTCAACTGCTTCTGGTCAGTAACTCCGACGTAAGGAGATAC
GTTTGTGAGATGCTGATGTCTTTAAGTGACGAGGAACTGGAAGAACTCTACAAGTATGGTTTTTTCTACTTCATTTTGTCTACGGTTCCGAATCCCAGAG
GAGCTGATACGGTGCCAGCCTTCGttccagaagcagcactaCTAAAACGGGTCCATCGAATTCAACGATCACCGGAGCGATACGTGGGGCAAAGTTATTT
GACGGACATGCTACCTGAGTCGCTCATTAGTATTTTGGATTCGGAGACCCCAGAGGATTTTGCCGACGTCTATAGCGGTCGTAGGCACGACAAAAGGGTT
ATGTGGTCGTCAACGATGCGATTGCATTTACACGAGATGATGGACGAGCATCTACGAGAGTTCAAACAAAGCTTACAGATGAGTGTCACAGCGAAGTACA
GCTACACCCCGATCCCTCCGATATCTTACCTGGAGCTGTCTGGTGACGTCTATTGTAATGGCTTTTATCTTTCGACCTTCAACCAGTCTAACtctgatgc
tgaagaagtagaGGATCCTGTTTTTGTGATGAAAAGTATTGAGGAGAAGTGGAGATATTTGGCGCGGCGACAAGAGGATGGCATGGAGGAAAATTTGGAT
CACTCAGATGCATACAAAGTATTTGGCTGGAGCGAAGATGCAACATTTTCATCGTCTGACTTGCGCACGCGTTATCGTGAGCTGTGTCGGCAAGAAGTCG
AAGTGAGTACAGTTCGTCATGCATTCGATTCCCTTTGTGCTGCACTTGAGCACAAGAACGAAGCTAACGGAGGGCGGACGTCTGATGATGTTATCGAAAG
AATTTTGAAGTCGCAATTGCGGTTACTGGACAAGTACGGCTTTCAGTTCTTTTCGTACGAGGCATCGACGCTTGACCTGCTCGTTCGCGTATTGTCATCT
CGACCAACAGGCGAGTTTAAATTTCGAAGCCTCGCAATGAAAGTGTTACAGCGGCTACTCTCGGTTGCTCCACAGAATGGCCCACTTCTGGTTAAGATCG
ATGGTAGTTGGGATGCAATCCTCGACTTGGTGGAAAATTGTGCATATGGACACGACGTGGGAGCGAAAGAGAGCATGTTCTCTATCCTCCAATTGCTCCT
AGCTTCTGAAGAGGGGGTACAATCACTTTTGGATGGAGAAAATAATACATCTAGCGAGAGGCCGCCCTCGAAAACCTTTGATTTCAACGCCTACGGGGAC
GATGACAACAATTCATTTTTTACCGCAACAGAGTACACGTCGCAAAATGGGTCAAGCAAGTCCAGGTATGCCCATCGTGTGTATTCATTGCTAGATGATG
TAATTCTTTCATTCGAGAACATTCAGCCATGGCATATCCAGAAGATGTCTTTTGAAATCGCGTCATCGCTTTGTCGGAGTCGTGAGCTGCAAGAACAAAT
CATGACATCAACCCGAGTATTCTGGAAGGGTCTCTATTTAATCTTGGCATCAGCAGAGAGTTCATCAGGAATTGACACAGCACAGGAAAGTACCACCACA
TTGGAAAAACAGGAGCGTGACATGTTGGAGAGTGCCTTTAGCGCGCTTCGATCGCTAGCGTTGGGTCCAGATGGCAATAGCCGATCGGCAGGACTTGACG
CCTTAACAAATCTCCTTCCGATGGACTTCTTGGATTGCCTCGAAAAGCCTAACGGACATGACTTCTGTACCATTTTGCTTTCAGATATTCGCGAGCCGAC
ATGTATCTGGAATGAAAATACGCGAGCTGAACTCTCTGAGCTTACTGAAGGATTCTGCACGGACCCTAGTGGAGACGGGATGTCGTTTTTGGAAAGCGCC
GCAAACTATATGTACGATGGTCTCAACAATGAGCCATTCGTCGGAGGAATCTATCTGCTAATCTTACTGGAGAAGGACCCGTTAGCGATTACTGAGGATA
TGCTGTATCCAGTTACAGCCGTTGACTTTATCGAGTCGCTGTTCTGTTTCTTGAATGAGAGCAGGGATCCTAAACTCGGCATTTATTCGGATACGCTCCC
TGCTTTAGACTGCTTAAGCCTTCTCTGCGACTTGTCAACCTTCAGAACTGCGATTGTGGAAtgcttggagcagcacaTTGATGATGTAGATCCGGTGAAT
GCCTCGATTTCGGTGGCAACTCTCGGCAGATATTTGTTGCCGTTTGACGGCGATGATAAGACAAAGGCTGTATCGATATCTTCTCGCCGGTCGTTGTCGA
CGTACGGATTTAAAGGCAAGGCGGATAGTGGTGATGTGCCTGCTGGGATGGAAGCTGAGTTTGGAAATGTCGATTATTTGGCTCGCCAAGAACTTGCGCT
GCTTATCCTTAACAAGATTTGTGGATTTGAGTGTAACCTGGAGCGTATGCTGGCACCTTTTTGCCAATTCACATGGTGTCTTCAGGTGATCACAGATCAT
CTTGACTATGAGCAGGCATTTTATGCGCTGTCCTGCTTGGCCGAGCTGTGTGATACTTGTCTAGTTGTTGCTGAGTACGTGCAATATAGTGGGCTATGGG
TGGAGATATTGGGTATCGCTCTTCAATCCAGACAGCACGTTCTCCACGAGCATTTTCTTCGGGCAGAAGCGCTACGAGAACCTGCGTTTGAAGTTTTGTA
CGCGCTGCTGATGAAGGACGTTGCTTTGCGGGAAAAAATGTACAGCGGTCTGTGTCGATTTCTTCCTTACCCGATCGTGTATCAAGTTCATCTGGATCCT
AACAAGGCAACTCGAttcttcgacgacaatcACGAAAAGAGCGACTTGATTTGGAATTCTCACAGGCGAACGGAAGTGCGTAAGAAACTCGACCAAATTA
TTTGCCGGAATCGAGTGGAGCGGTCTATAGCAAAGCGCGACTCGGTTTTGCTTGACGACGAGACTGATTTTATCCCGTACCCCCACAACTTTGTGGCAGG
TCTGTACATTGATCGCTTCTTGTCTAGACCGGACCCAGAAAAACTTACAAATCCAGCATACAATTTGGAGTTGCTGTTCCACGAGTGGAGGACGCAGCTT
GACGAACTGTTGAGCTTCGATCTACAAAATCCGCCAGACAACCTTAAGAAAACCGCTGATGAAATCGACAAGTACACCATGGCGATTACACATATTTTGC
GAGCATCACTTGATATTGACGAGAGCATCGCTAACAATCGCATGCCGGAGCAGATCGTGAAGCTCGTACGCCATTGCAATCAGCACTTGATCACAAACTT
CCCGTATCGCTGCATCTTGCGCATCGCTCGGCGTTTAGTGCAGTTTCCTGAGATCATCTCCAAAGActttgtggagctgcttaCTTGCCGAGTCACTATG
CAGCACCCGGACATTCCGTCTTTGCTGAAGGCTCTCCGTCGTGTATTAGAAGCGCGCAACACGGTGTTGGCAGAAACCGGAACAAAGGATGACCCTGATT
ACTGGTTGAAAGATCTGAAATACTACCCCCAAATGCTGGCATTCCTGGAAGGACTAGTGGAGAACAAGGAGCAGATCGAGGCCCCGCTTCTTTCCAATGT
GAATCGCGTTCTTCGTATCATCCATGCTGAAGTACCCAAAGAAACCAATCTGAAGCAGATGTCGCGGAGTTTTATGGGACGTTGGCACAACTTCACGCTG
GAAAGCAGACCGTCGATGCTCCGAAACTCAATTAAGACAGGCCAGTCCGAAACGAAGCCACCAGTGaccacagcgacaacaaccaTTGAATCGGTCAACC
CAGACATTCTGAGTACGCAAAGCTTTGACGTGGATGGAGCACGAGAGCGACCATCCAATGTTGGGAGCAATCAAAGCTTCGATGTCGATGGCGAACGAGA
ACCTTCTATCCGAGTCGACATCAAGGGCGTACCTGCAGACCGTGAAATTGACATCGATGGCACCTTCATCCAAGCCCCTCCAAAGAGCATCaactttgct
gctggcgctgtcgAGGTGGGGGATGCTGTCGCGCCTCGCAGCTTCCGGTACAAGGGTGAAGTTGGTCGCAACTCGCCGTTGCCATCTCCCACGTCCGTCC
GCTACTCTACGCTCGGAGCTCAATACGAGCCGATCGACTCTCAATACCACTCGAGGAAGGCAGCCGAATACGATGAACATGTAGATGACTTGGACATTTT
CGCCACGCGACCTCGTCGTGGGAGTGTCCCGTTGAAGCCtgacgacgtggaggtgAAGAGGGTGAAGGGCTTGACTTCTGCtgatattgctgctgcaggc
gacATCCCCATGAGCAGCATCAAcgtcagcaacttcatctcgCAGGCACCAACCACTCGACGACAGCCACAAGCGACTGGAGAAGTTCCATCAGAGACGA
GCACCGACCTGAGTCGACTGAGCGTAGCAACAAGTGCCATGAATTCGGAACGTCGCTATTCACTGCTGGACTCCTGGAAGCCACCAAGCTCAACAGCCCC
AAATTCGTCGCTGACAACGCTCACTATTTCTCGACGAGGtcgccgagctgctgcagtgtacAGCCGCCACAAATCGTCCAAGGATCGAAAGCGGTGGTTC
AACAGATAGTTGAAGTCATTGAAGTTGACCATGAGTTTATTTCCCCTAAATTTTATTTCTCCTAAATTTGAAATAAGATACccacaagttgaagttgaga
CCATCATTCCGCATTTCCGCATCAAGGTAAGCGATGCGTCCATGGCCTCCACGGGCTACTTGTTAAAGCTCTAACCGTGTATATGTGGCTACGCAGTTTC
AACTAGTGAGTTGAGATGAATTGGCAGCAGAAtgcggagctgcagcgtcctTTTGGGGCCCCAAGTCACCACGAAGAGAACAATGCTGGCGCTAACGATG
TCACCGCGGAGGATAGCAGCATCCTTCGGTACATTAAGACGTTGACAAAC