Description :
From Genome Similarity Track
Location :
Scaffold_546:2328- 4056
Transcript NameFunction/comments
Phypl_g9300conserved hypothetical protein
Phypl_g9301hypothetical protein PHYSODRAFT_488439

Sequence
1728 bases(100 bases per row)
CCGCTCGCGTTGGCCACACCGCCGTCTACTCGATGGGCATGCCGCGCGCCCGCTTGGCCTGCTGGATGgccggcagcttctgcatcgtcgccgccgcagc
caacgccgccatTGTGGCGCTCCTGTAACTTATCGGCAGGCTGCAAGTTCGTGGCAATCTccctgcagcttcgcctATCCCGATAAGCTGGCCAGCCCTT
CAAATATAATCATTGTCCACTCTTGTTCGCAGCCTTTCGACCCTCTTCACCTTGTCCGAATGGCAGAAACGATAAAAAAAACCGGTAAAAATAATGTTCG
TTCAAGTTGTGCATTTGCATATCAACGGGATGCCCGACGTCTTGTTTGCCCTACTCTAACCactcgtcgacgtcgagttACTGCACGGAGCATCCCCAGC
CCTCCGGCTCCTGGCCAGGCAGGTAGTGCTTGCCGCTCTTCCACTCGGGGCAGcggtcctcctccttcacgccTGGCGACCACAACAGCACACAAGACGC
GTTATTATAGATCCTCCTCTCCTCAGTGTCAACTGCTCAGGACGCACCGCTAAGCGCGCTCTCGACGTGCATGCCGCAGCCTCTCCACGTGGGCTTGTGG
CACGTCGCGCACTCGGTCTTCATGCACATTCTGGCGATTGGGTCCTTCAATTCACTTGCGAGGCGGCTGGCGAGTTCACGAATGAAGCGGTGACCCGGTT
TTCGCGCAAGGCAACAACGTGCCTGACCCGCATCGAGGTCAGGCAAGGCCATGCGGCTGACATTCCCGCTTAGGTTAAGGATTCACTTAAGCGGGGATAT
CAAATGTTGGGATAACGTTAACTTCAACTTTGATCAACTACGTGTATTACGGTCTTCCAGTTTGGTCGGCTAGTGCTTCTTCCTTGACGCCTATGGAGTG
ACGCAACAACGTACGACCCCCAAGACTATCAGCAGATGCACCGATGAGAGTGGTTGCCGCAGCGGCTTCTGGCACGTGGGGCATTCCATCTGCATGAGCT
GGATCGTTGTCGGTTTGGGCACTGAAGATGCAAATGAGATCAACTAGATTGCGGTAGCCTGCATTAGTCCACCAGGTGCGGCCAGCTACCGTTTCCCTAC
ACTATATGAGCAACCGCTACGTCGAAGCTGGCTACACGCGTCTTGATTTACAGGTAAACTAAAAACAAAACAATGAAGTACTTGTATTTTGTTTGAGTAA
TTTGAGTAAAGTAGTTACAAACCTTGTTTTGATGCTGATTATGTCGAGGTTGGTTCATACATGGATAGGTAGTAGTTCTACTGCCTTGCTTTGATTTCTA
GCTGTAGAAGGATTTTTCGTGGTTTCTTCAGTTCTGGCCGACAAACGGGTTGGCACCTCCCTTCTGGTCGAGACCAGCAAACGTGTGGTTCGCGACGCGG
TGGTTTGTTCCGTCCGCGCGGATGCACTTGATCATGTCGTAGACTTTGGCGTCGTCCGGGAGGTTGTAGTAACTGCGACCGATAAGGGGGGCGGTCGTGG
TGCACCACTCGTCCAAGTGGCCgtgctccatgtcctcgagcAAGTTCGTGTACGTCTTTACGGTCTCTTCCTCCAGGAAGTCCACGAAGCGGTGGCACGT
CTTCGGGGACACCATGTAggccaggaagaaggccgGGAAGGAAATGCCctgcgcggccagcaccgaAATTCGGAAGATCCACCCAGGCTGCTTCATGTAC
ATGAAGATCAGCAGATGCATGCGATCgt