Description :
From Genome Similarity Track
Location :
Scaffold_169:23279- 24748
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_169-fgenesh-gene-0.7DNA replication licensing factor mcm4

Sequence
1469 bases(100 bases per row)
GCCACGTTCATGAGCCGCAGCGCTTCGTCCACGTCGCTCTTGTAGATGATCTCGCTCAGCTTCATCTTCGCCAAGGCCTCAGCGATTCGGATGAGACTCT
CGAGCTGCCGCGGCGTCGCAGTGATGTTCTTCTTCGACGCATGCGCGCCACCCATTCGTCGCAGGTCCAAGTACGCTGCGACGAGTGCATCGCGCGCCTC
GGGCAGCAATCGTGGCTGGATGTTCTTCTTCGCGTACGAAATGTACTCCGTCAAGAGCTTCATCGGCACGAGCTGTGGCCCGCCTGTCATGTTATTCTGA
CGCTGTAGACGGGTCTCTTCGTCGTAGTAGAGCGCGACAATGTGCTTCGCCAGCTTGCGGTCGGACTCGGCTTGCGGCTTGTCGAGGATCAGGTAAATCA
AATCGAACCGCGACAACAGCGTCGGCAGGATGTTGACATTCTCGATCACTGACTTGTTTGGGTTGTAGCGCGACTCGATCGGGTTTGCAGACGCTAAGAT
CGACGCGCGCGCGTTCAGCGAACAGATGATGCCCGCCTTGGCGATCGACACCGTCTGCTGCTCCATCACTTCATGCAGCACCGACCGCGCCGAGTCGGAC
ATCTTGTCAAATTCATCAATGCAGCAGATGCCTTCGTCCGACAGCACCAGCGCGCCGGACTCGAGCACGAGGTCGCCCGTCTCCATGTCGCGGATGATCG
ACGCGGTGAGACCCACCGCTGAACTACCCTTGCCGGACGTATAAATGCTTCGTGGTGAGAGCTTGTGCACGTAGGACAGCAGCTGAGACTTGGACGTGCC
AGGGTCGCCGCAGAGCAAAATGTTCATGTCGGACCGCATCGTCTTGGTCGGCATGAGCGCGCCGTCGATGCCGTCGGGACTGAAACCGGCCGTGTTCCCT
GCCTTGTCTTTGCGTGTGCCACCAAAGAGCATACACAGAATGCCCTTCTTGACGTCGTCGAGCTCCCAGATCGACGGCGCGAGCGAGTGTGCGAGGTTCT
CGTACAAGTTCGGGTGCGCGGCGATCTGTTGGAATTCGCGTAGCTTCGCCTCTTCGATGGACTGGATGTTGTTCGCGTCGTCGTCCATAGGTACGTCAGC
GTCCGCTGTGGTCCCGTCAGCAACCCCGCCACGACGTGCGAGCTCATCGACTCTTCGAAAATGCACCACGTCAATGTACGTTTTAAACACTGACTTGACA
ACCCGCTGGCGTGAAGAAGCGCGCAGCGGCACAGCGCGGTAGATACCCGTGACTTCGATCTTGTCACCCGGTCGCACGTCATCAACGAGGTCGTCGAAGG
CAAAGAGCATCACCGTGTATGGCGTCTCGCCCTCGGGGATCGCATCCGGGGTCTCCTGCATCTTCACCATCTGCTTGTCCGTGAACGAGCAGCGATTGTG
GATCAGCTCCATGCACAGTCTCGTGTTGCAACGCTCGCAGTACGTCGGCTCCTCGATGCGGCCACGGTC