Description :
From Genome Similarity Track
Location :
Scaffold_58:232706- 235076
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16570NADPH-cytochrome P450 reductase

Sequence
2370 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTATT
TTGACCGGTAGTATATACGGACCGTCGGTAGTGTATGCCAGTACCGTGTTTTTTTACCGCTGATAGATAAGCCTAGTATATTTTCAAGGGATATAGGTTT
TGTATGCTGCTGCTCATCGTTACTTCATGTCATTTTAATTCTACTTAATCGTTACTTCAAATGTATTTGGAAAAAAATCTGTGGCCAACGAAGAGCTCAC
ATCAGCTGCCACGCACTTCCGCCATGGCCTCCCGCGCGGTCTCCGTCTTCTACGGCTCACAGACCGGCTGTGCCGAGTCCATTGCCCAGGTTCAGTGCTG
CACTCTGCTTCTATGTTCGCGCATTTGTGTCGTTAAATTAATATTTTTATGATATTGGCAAATTCCGCAGCGCATTTACGACGAGGCCCTGGAGAAGCAA
TTGGATGCAGAGCTACACCCGCTCAATGAGTTTCAGAAAGTGCGTTTTGGTTTCTTACTCTTTAGTGCTACAGTGGTGCTGGTGCTGAGTATTGCTGCTT
GATAACAGAGCAAAGTTGAGACGCGCGACGGACACTTCGTGGTCATCGTGTGCTCCACAACAGGCAACGGCGACCCGCCTGACAACTGCGGCAAGTTTTG
GCGCTATGTGAAGCGCCGAACGCAACCCGAGGACATGCTTGCCAAGCTGCGGTACACGGTATTGGGACTTGGAGACACCAACTACGACAAGTTCTGGTGA
GACAGGATGGAGTGGCAGAGGAGTACGTGTGGGCTGACACTTTGGGTTTTATTGATGTAGTTTTATGGGCAAGAGCATTGAGAAGCGCATGCGAGAGTTG
GGAGCGCAGAGCTTCTACGAGTTCGGTATGTGCCGTTGCCATCCCACTCCTTAGAGTCATACGTTTCGTCGTATGTCGTCTTACGATAATGCCATTTGTG
AGTAGGTGCAGCTGACGAAGCGATGGGACTTGAGGACAGTGTGGAGCCATGGCTCAATGGACTATGGGAGGCATTTGACAAAGCAAATGGTGTGATAGAG
GTCACCGCTGATGTTGTTACCTCAGTTTCGGATATCAAGGAAAGCACTGCAAATGGTGGTAACTCACTGACTACTGAGAAAACGTCGTCGACATCGACCA
CTGTGAACACGCCGTACATCTTGGACAACCTTATTTCGTACGAGAAGATGTTCGGCCCCCTGGACACTCCGACTGAGGTTCCTGAGGACCTCCCACGTCT
ACAACATTCGCTTCTGAGTGTGCATTTCCTGGGTGATGAAGAGCGGCAGAAACCAATTCACACGTCAACTACCGATGAAGATGATAAGGAAATTAGCTCG
ACGAACCCGTTCATGGCTTCATTGATTGGTGCTGAGTATCTTACCGCCCCACACGCCGAGAGAAAGGTTCTTCGTCTTGATATCGACGTCAGTGGCTCTG
GTATTCAGTATGTTCCTGGTGACTCGATCGGAATCAAGTGCCCCAACCGAACGGAGGATGTGGATGCTCTACTGGCACGCTTGGGAGTCAGCGGTGATGA
GGTTTTCTCAGCTGAACCGGTCGCCGCCACTAACGGACGTGCAGCAAAGCGGAAGAACACTTCGATTCAC