Description :
From Genome Similarity Track
Location :
Scaffold_8:232635- 236253
Transcript NameFunction/comments
Phyci_77201conserved hypothetical protein
Phyci_77202Hypothetical protein

Sequence
3618 bases(100 bases per row)
GGTGAAAGGATTAGGCAAATACATTGAATGCTGCAGTCGATGAACACTGAAAGTTCTGTTAGCATGAAATATCTAGCAGCGCTTAAGCGCAGCTTCCTCC
TGCAGCAAACGAAAGCCTCGAAGGTACTGCTGGCACTGAGCAGCAGTATCTGCCTGTAAGTCCAACGTTCGGCAAGGGTGCACGAACACGAGCGAGAAGC
AGCGGGCAGGTGCATCAGGGCGCTGACGAGCGAAGGTCTCCGTCGTTGCGCCGGGTAACACCTCAACCAGATCGCACGTGTCTACTTTCGCGTCGGCCTT
CGGCTGCATCAACGAGCCGTGGGCGACCGACGTTGCAGGCGAACGCCAAGACAGCCAGTGGCACTGAGCATCTGCATACACGACACGTTGGTGAGGCACG
CCGCGAGCCCCGAACTTGGTCACGACGATGCCGTTTTCAAGCTGTCTCTTGAATTGTGCGAGAAATTCCTGGTCCTTTGCTTGGGCTGTAGCACGGGCCC
GACTAGCACCTTCCAACTCGTCCACCGCCACCTGAAGTCGAAGTTTCTCCGCTCGCTCGTCCTCGCAACGCTGCTCGAGGTCGTGAATTTGGCGCTTCAG
ATCGTTTTGTACGGCTTGCGCTTCCTCCCCCACTTTCTTCCGGACGACTTCGAGCTCAGCGCTAAACTCACCGCGCATATTGCGCTCGCGGTTCTGAGCT
TCGCGAAGTTCCTCGTGTAGTGAAGCCAACAACTGCTTGCTTGTAGTGTTCACCAACTCCAACGCGCGGACTTGCTCCTGAAATTGTTGAAGCTGCTGGT
AATGACACGAGATCTCTGCTAGCAACTCCTCTCGATGCTCGTTCAGGTCAAGAGTCCCGTCCTTCAACCGATCCAATAGTGGAAGTGATGTAGCTGGTGC
CTCCGTTTCTGCTTGTGGCGGAAATGCGGGCTTTTCGTGACTTGGTTGAGCGGCAGCAGGGGTATCTGTGCCAGGGCGCGTTTCGTCGGCTGCTTCAGCG
CGCGCGTTGGCAGCCTCTAATGCAGCCTTCAGCTCTCGCACCTGCTGAGTCTTCGCTGCATGCGAAGTTCGAAGTGCTGCGAGCACAACCTCGACAGCGC
GATGCGCTCGTTGAGCGTCGACAAGCCGGTCGTGCAGTTCATCAACTTGTTTCTGGGTGTCTTGGTGCTCCTCCTGCATCTCCTGCCACTGTAGTGCCAG
CATCTCTTTCTCATGGCGAATTTGGTTCACTTGTTCTCGACTTTCTTCAGCAGCCGCCGTCTGCTCTGCAAGTTGAGCCTGTAAGCCCTGCAGTGCCTGC
TCGAGCTCTTCTTGGTGGCGTTGCAGCTGCACTTGTTCGGTTTTCACTGCTTCCAATTCGGCTTGCTTTGCTGTAGACGCTCGCTTGTGTCTGAGTAGTA
GTTTATTGACTGCAACCATGTCGTCACGCTCGCGCTGGACCTTGCGGGTCTCCTGTAGTAAAGTTTCAAGTTGACGCGCTGCGACGTCCTGTTCCCGCTT
CACAGCCTCTTCACGCTCTTGCTGTAACGCAGTAAGTTGCTCTCGCACGGAGCTGAGCTGCTGGCTTACTTCAAGATACTCGGTTTTAAGGCTGATCACC
AGCTCGTTCGAACCTTCTTCTCCTAGATTGGTTGTCTCGGGGAGCTGAACACAGTCATTTTTCGTCTCGAGAAGGGCATGGCTGCTGCGCCGCGAGTTGG
GATTTCCAGGTCCCATCGATAGACTGCTTCGGCGTCGAGGTTGTTTCGATGACGCGAGGCTACTCAAACTTTTCGATCGCTCTTCGAGGCCTGCATTCAC
TAACCCAGAGGTGATGTCGGCCAGTAGCAAGGTCAACGCTGGTTTCGCATCGCGCATCCTGAAAGCAAGCAACAGCAGCATTTAGAGAATGTTTCTAGCA
CTCAAGACAGCACACACAACACACTCACATCTGAAGAACATCCGCGTACGCAATATTGGCGACGTCGTTGCCATTCACTCCGCGCACCCGCAGTTGGTCG
ACGATGATGCGAGAGTAGTCGCCTGCAGCTCGGCACCGCGCATTGTAATCTGCAGCGAGCCCCGCAGGTGCCACATCCCGAACGACACAGGCGTAGCTCT
CAGCAGGCACGAGGCTGAACTTGTTGCTTTTCGCGGCAGGCTGGAAGCCCAGCCCCACAGGCTTGCTGTCGTCGAAGAAGACGCTGAACTCCTTCTCCCA
GCGATTCGAGCCGTCACTTTGCTTGGCTCGGAACGCGGCAGTCAGCAGCTCGTCCCATGCTCGCTCCGCACTCGATCGCTGCCCCTCTGGAGCGGGGCGG
TCCTCCTCTGAATCGTGGTTGATCGACGACCCAACAGTAGACACCTCGCTCCACGGGGGGCTGCAGAATTTGAGCACCATACTCGCTGTCCGGGTCCACG
TCCTCACTGCTGCTTCCTCCGGTCCGTTGCAAACGGCGTGTGGCGCTGCCGGAAGTGAACGAAATGCTGCTGCTTAACCGCCACTAAGCCCGGGATAGCC
TGCATGCTCTCACAACGAAAATAGTGCTCCTCGTCATGCTCGCTACACATCAGGATGACCTCCAAAAAGAAAAAAAAAAACATGTTTCAAGTTAGTCGCT
TGGGCTTCTGCTCCATTCACAGCCCAGATCACGTCACTGCTGCGGCGGGCACCCGGGCACAAGGCACGCAGCGCCGGCGGAGCAGGTGGGGGCGTGCGCC
CTCACAATGGTCCCCCAGAGCTTGCACGCGCCGCACCTCTTCTCGTCGTGCGAGGCCTTGCCCTTCATGCTCGCGCGATGAGCTTTCACTTTGTCTACGA
AGGCCCTCGACGACACACACAGCGGGTTCGCGCAGCCGCCGGCACTGCACGTCGACAGATGCTGCAGACCTCGCAGCATCGACTGCATCTGCGCGGCGCC
GGGCGTCGCGGCCTTGGCGGGCGGCAGCTTCTTGGCGTCGGAGACCTCCCCCACCGACGTGGGGCTCAGCGGCTCTCGACGCAGCCGCTTGGCGCTGGGC
GGCGCCGGCAACTGGCAGCGCAGAGGCGACAGCAGCGACGCGGTCGTCGGAGCGGCGCTGGAAGTCGGCGCTCTCAATGCCGCCGGAGACGGAGAGCGAG
CGAACGACACGAGCGGCGCTGCGAACGCCACGCGAGGCGGCGTGCTGGAGGTCTGCGAGTCGCCGCTGAGGCTGCGCTTGCGGGTCGGGAGTCCATGGAC
GTTGGCGACGATCTGGGCCCGCGGGATGGAGTAGGACGGCGGCGCAGGCGACGGCGACGGGAGCTGGAGCGAGGGCAACGCGGCTAGCGGGCTGAAGGCG
CCTCGATCAGTGCCGCCGGTCGTAGGGGGGCTCTGTGGAGCATGGAGACACACAGGCGTGAGAAGCTGGAGGCTCAACGAGGCAGGAAGGACAGGAGAAA
CGCACCATTTCAGCGCCATCGGCCACGAGGAGGAGGCGCGCCAGCTTCACGACGCGGCGGGGCACACGCGTCCACAGACGGAGAGAGGAAGAGGCAGGGA
GCAGCAGCGCGGGCAGGACGGCGACGCTACCGGTATTGGAATTGGACTGCAACTCGACCTGAGACTTGTGCGAAGAACAGGGCTAGGGCGGCGCGTTCCT
CGAACGCGCCGTATGGCT